\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604548114:

Variant ID: vg0604548114 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4548114
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCTCCTCGCGGCCGTGCCGGCCCATTAGGCTCGCCCGAGCTGCGCAAGTCCCTCGAGCCGCGCCAATGCCACCCGAGACAAGTCTGATTCACATCTCT[C/T]
GTCCATTTCCTTTTCCAAAGGATTTAATAAATCCTTTTCCTTTAGACAGAAAATACAAATAATCTTAGGAAATCCATATCTCCTCAACCGCTCGCCCGAT

Reverse complement sequence

ATCGGGCGAGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGTATTTTCTGTCTAAAGGAAAAGGATTTATTAAATCCTTTGGAAAAGGAAATGGAC[G/A]
AGAGATGTGAATCAGACTTGTCTCGGGTGGCATTGGCGCGGCTCGAGGGACTTGCGCAGCTCGGGCGAGCCTAATGGGCCGGCACGGCCGCGAGGAGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 7.60% 0.32% 3.70% NA
All Indica  2759 94.90% 0.60% 0.36% 4.17% NA
All Japonica  1512 74.10% 22.20% 0.26% 3.37% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 75.50% 2.20% 1.08% 21.29% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 0.60% 0.64% 2.04% NA
Temperate Japonica  767 83.20% 16.30% 0.13% 0.39% NA
Tropical Japonica  504 61.50% 30.00% 0.40% 8.13% NA
Japonica Intermediate  241 71.80% 24.90% 0.41% 2.90% NA
VI/Aromatic  96 94.80% 4.20% 0.00% 1.04% NA
Intermediate  90 84.40% 5.60% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604548114 C -> T LOC_Os06g09030.1 upstream_gene_variant ; 925.0bp to feature; MODIFIER silent_mutation Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0604548114 C -> T LOC_Os06g09040.1 downstream_gene_variant ; 3763.0bp to feature; MODIFIER silent_mutation Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0604548114 C -> T LOC_Os06g09030-LOC_Os06g09040 intergenic_region ; MODIFIER silent_mutation Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0604548114 C -> DEL N N silent_mutation Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604548114 NA 6.89E-07 mr1636 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604548114 5.70E-07 7.32E-08 mr1766 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251