Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604526918:

Variant ID: vg0604526918 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4526918
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.04, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

CGTCACCGCGGCCATCTACGCTAGCAAGGTGGTCTTCTTCTTCAAGGCCATCCGCCGATGGCACGGTCATACCAATTTCGACCGTTAATATTGTCCATTT[A/G]
ATGAAGACTAGCTATGCTTGCAATGCATAATTTTCAAATAAAATATATACTTCCACTATGTCCTATGCTACTAACATATATGCAGGAGAAGCACACATAA

Reverse complement sequence

TTATGTGTGCTTCTCCTGCATATATGTTAGTAGCATAGGACATAGTGGAAGTATATATTTTATTTGAAAATTATGCATTGCAAGCATAGCTAGTCTTCAT[T/C]
AAATGGACAATATTAACGGTCGAAATTGGTATGACCGTGCCATCGGCGGATGGCCTTGAAGAAGAAGACCACCTTGCTAGCGTAGATGGCCGCGGTGACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.40%	22.70%	10.11%	38.76%	NA
All Indica	2759	16.30%	5.50%	16.56%	61.62%	NA
All Japonica	1512	57.30%	36.40%	0.79%	5.49%	NA
Aus	269	0.70%	98.50%	0.00%	0.74%	NA
Indica I	595	16.10%	3.40%	28.74%	51.76%	NA
Indica II	465	11.60%	4.30%	17.85%	66.24%	NA
Indica III	913	17.90%	2.80%	6.24%	73.06%	NA
Indica Intermediate	786	17.30%	11.10%	18.58%	53.05%	NA
Temperate Japonica	767	94.90%	4.60%	0.00%	0.52%	NA
Tropical Japonica	504	9.10%	75.80%	1.59%	13.49%	NA
Japonica Intermediate	241	38.20%	55.60%	1.66%	4.56%	NA
VI/Aromatic	96	12.50%	80.20%	2.08%	5.21%	NA
Intermediate	90	15.60%	30.00%	7.78%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604526918	A -> G	LOC_Os06g08960.1	upstream_gene_variant ; 1958.0bp to feature; MODIFIER	silent_mutation	Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0604526918	A -> G	LOC_Os06g08990.1	upstream_gene_variant ; 4609.0bp to feature; MODIFIER	silent_mutation	Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0604526918	A -> G	LOC_Os06g08980.1	downstream_gene_variant ; 3066.0bp to feature; MODIFIER	silent_mutation	Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0604526918	A -> G	LOC_Os06g08970.1	intron_variant ; MODIFIER	silent_mutation	Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N
vg0604526918	A -> DEL	N	N	silent_mutation	Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604526918	NA	6.60E-17	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	5.72E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	2.20E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	1.07E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	2.01E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	4.43E-19	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	2.83E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	1.46E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	9.05E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	1.73E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	1.63E-06	NA	mr1115_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	1.23E-17	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	2.21E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	9.61E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	9.88E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	5.69E-16	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	1.46E-11	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918	NA	7.80E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251