\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604526918:

Variant ID: vg0604526918 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4526918
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.04, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCACCGCGGCCATCTACGCTAGCAAGGTGGTCTTCTTCTTCAAGGCCATCCGCCGATGGCACGGTCATACCAATTTCGACCGTTAATATTGTCCATTT[A/G]
ATGAAGACTAGCTATGCTTGCAATGCATAATTTTCAAATAAAATATATACTTCCACTATGTCCTATGCTACTAACATATATGCAGGAGAAGCACACATAA

Reverse complement sequence

TTATGTGTGCTTCTCCTGCATATATGTTAGTAGCATAGGACATAGTGGAAGTATATATTTTATTTGAAAATTATGCATTGCAAGCATAGCTAGTCTTCAT[T/C]
AAATGGACAATATTAACGGTCGAAATTGGTATGACCGTGCCATCGGCGGATGGCCTTGAAGAAGAAGACCACCTTGCTAGCGTAGATGGCCGCGGTGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.40% 22.70% 10.11% 38.76% NA
All Indica  2759 16.30% 5.50% 16.56% 61.62% NA
All Japonica  1512 57.30% 36.40% 0.79% 5.49% NA
Aus  269 0.70% 98.50% 0.00% 0.74% NA
Indica I  595 16.10% 3.40% 28.74% 51.76% NA
Indica II  465 11.60% 4.30% 17.85% 66.24% NA
Indica III  913 17.90% 2.80% 6.24% 73.06% NA
Indica Intermediate  786 17.30% 11.10% 18.58% 53.05% NA
Temperate Japonica  767 94.90% 4.60% 0.00% 0.52% NA
Tropical Japonica  504 9.10% 75.80% 1.59% 13.49% NA
Japonica Intermediate  241 38.20% 55.60% 1.66% 4.56% NA
VI/Aromatic  96 12.50% 80.20% 2.08% 5.21% NA
Intermediate  90 15.60% 30.00% 7.78% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604526918 A -> G LOC_Os06g08960.1 upstream_gene_variant ; 1958.0bp to feature; MODIFIER silent_mutation Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0604526918 A -> G LOC_Os06g08990.1 upstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0604526918 A -> G LOC_Os06g08980.1 downstream_gene_variant ; 3066.0bp to feature; MODIFIER silent_mutation Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0604526918 A -> G LOC_Os06g08970.1 intron_variant ; MODIFIER silent_mutation Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N
vg0604526918 A -> DEL N N silent_mutation Average:72.41; most accessible tissue: Minghui63 panicle, score: 84.005 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604526918 NA 6.60E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 5.72E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 2.20E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 1.07E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 2.01E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 4.43E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 2.83E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 1.46E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 9.05E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 1.73E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 1.63E-06 NA mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 1.23E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 2.21E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 9.61E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 9.88E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 5.69E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 1.46E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604526918 NA 7.80E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251