\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604517236:

Variant ID: vg0604517236 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4517236
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGACCAGTCGGAGCGCCGGCGTTGTAGCGGCGGCCATGGGGCGGCGAGCCGCCTGCGCGCCGTGCTGATGAGAATATGGCGGTGAGGATGCCGGTGAGC[G/C]
CCGCCTTGGCTGAAGTGTGATCGGCGCCGAACGGCGGCGCCGTCGCCGTTGCATGGTGGGGTGGATGATGTGACGGCGGAGGAGAGCCGCCGGAGATGGG

Reverse complement sequence

CCCATCTCCGGCGGCTCTCCTCCGCCGTCACATCATCCACCCCACCATGCAACGGCGACGGCGCCGCCGTTCGGCGCCGATCACACTTCAGCCAAGGCGG[C/G]
GCTCACCGGCATCCTCACCGCCATATTCTCATCAGCACGGCGCGCAGGCGGCTCGCCGCCCCATGGCCGCCGCTACAACGCCGGCGCTCCGACTGGTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 15.00% 0.83% 6.18% NA
All Indica  2759 91.60% 2.10% 0.58% 5.76% NA
All Japonica  1512 58.50% 36.60% 1.12% 3.77% NA
Aus  269 73.20% 0.70% 1.49% 24.54% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 72.30% 3.70% 2.58% 21.51% NA
Indica III  913 97.00% 1.00% 0.11% 1.86% NA
Indica Intermediate  786 90.20% 4.10% 0.38% 5.34% NA
Temperate Japonica  767 93.60% 4.30% 0.91% 1.17% NA
Tropical Japonica  504 13.50% 77.20% 1.59% 7.74% NA
Japonica Intermediate  241 40.70% 54.80% 0.83% 3.73% NA
VI/Aromatic  96 19.80% 78.10% 0.00% 2.08% NA
Intermediate  90 64.40% 24.40% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604517236 G -> C LOC_Os06g08960.1 missense_variant ; p.Ala307Gly; MODERATE nonsynonymous_codon ; A307G Average:64.569; most accessible tissue: Zhenshan97 panicle, score: 78.302 unknown unknown DELETERIOUS 0.01
vg0604517236 G -> DEL LOC_Os06g08960.1 N frameshift_variant Average:64.569; most accessible tissue: Zhenshan97 panicle, score: 78.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604517236 NA 7.50E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.27E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 3.51E-08 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 2.13E-07 1.03E-20 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 3.23E-15 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 7.39E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.59E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 8.49E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.06E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 2.37E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 3.06E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 6.95E-06 NA mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 4.20E-07 3.40E-21 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 2.49E-17 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 2.01E-06 2.59E-07 mr1187_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.99E-15 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.16E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 8.70E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.12E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 9.15E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 1.53E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 4.50E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 9.01E-14 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 7.94E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604517236 NA 3.04E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251