\
| Variant ID: vg0604502626 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4502626 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
ACGAAGCCGGTGTAGAAGAAGAAGCCGATGGTGGCAAGCCAGAGATCCCTGGTCAGTGGCTTCACGAAAATCCATTGGATTGGCTTGGAGTCGTTCTCCT[C/T]
CGGCACCAGCAGCGACACACCGGACGACGTGTATGGCATCGTGAATTCCACGAGGTTTTCTCGGTCGGCTGTGATGGTCACGTCGCCCACTGCTGCGCTG
CAGCGCAGCAGTGGGCGACGTGACCATCACAGCCGACCGAGAAAACCTCGTGGAATTCACGATGCCATACACGTCGTCCGGTGTGTCGCTGCTGGTGCCG[G/A]
AGGAGAACGACTCCAAGCCAATCCAATGGATTTTCGTGAAGCCACTGACCAGGGATCTCTGGCTTGCCACCATCGGCTTCTTCTTCTACACCGGCTTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 5.10% | 4.27% | 1.33% | NA |
| All Indica | 2759 | 93.40% | 5.30% | 1.30% | 0.07% | NA |
| All Japonica | 1512 | 80.80% | 5.40% | 9.99% | 3.77% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 70.30% | 25.20% | 4.09% | 0.43% | NA |
| Indica III | 913 | 99.30% | 0.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 3.30% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 84.00% | 0.80% | 9.13% | 6.13% | NA |
| Tropical Japonica | 504 | 76.20% | 12.90% | 10.52% | 0.40% | NA |
| Japonica Intermediate | 241 | 80.50% | 4.60% | 11.62% | 3.32% | NA |
| VI/Aromatic | 96 | 79.20% | 5.20% | 13.54% | 2.08% | NA |
| Intermediate | 90 | 84.40% | 11.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604502626 | C -> T | LOC_Os06g08930.1 | missense_variant ; p.Glu14Lys; MODERATE | nonsynonymous_codon ; E14K | Average:22.594; most accessible tissue: Zhenshan97 root, score: 38.035 | benign |
1.115 |
TOLERATED | 0.45 |
| vg0604502626 | C -> DEL | LOC_Os06g08930.1 | N | frameshift_variant | Average:22.594; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604502626 | 3.61E-06 | NA | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 3.73E-15 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 3.18E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | 2.57E-06 | 2.56E-06 | mr1621 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 6.41E-10 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 5.30E-12 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 5.47E-11 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 1.16E-06 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 3.46E-14 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 5.26E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 6.43E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 9.97E-11 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 7.95E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 1.01E-10 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604502626 | NA | 1.98E-11 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |