\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604439758:

Variant ID: vg0604439758 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4439758
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, C: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGTGAGTACTTATATTGGTGAGACGCTGTATGCTATATTCTTGGCAGTTCTTGGTCTCGTCTTGTTTGCGCATTTGATTGGAAATGTGCAGGTACTTT[C/T]
ATGGTGTAAACTCCATTTACAAATTGTTAAAATGCTTTAGTTATGAAGTAACTTTGTTGTTCATTTTTGATATCCCATTCCTTTGTTGTCTGATATATAA

Reverse complement sequence

TTATATATCAGACAACAAAGGAATGGGATATCAAAAATGAACAACAAAGTTACTTCATAACTAAAGCATTTTAACAATTTGTAAATGGAGTTTACACCAT[G/A]
AAAGTACCTGCACATTTCCAATCAAATGCGCAAACAAGACGAGACCAAGAACTGCCAAGAATATAGCATACAGCGTCTCACCAATATAAGTACTCACAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 32.60% 0.13% 0.00% NA
All Indica  2759 85.60% 14.40% 0.07% 0.00% NA
All Japonica  1512 45.70% 54.20% 0.13% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 89.60% 10.30% 0.17% 0.00% NA
Indica II  465 65.20% 34.80% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 81.00% 18.80% 0.13% 0.00% NA
Temperate Japonica  767 75.20% 24.80% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.70% 0.20% 0.00% NA
Japonica Intermediate  241 32.40% 67.20% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604439758 C -> T LOC_Os06g08850.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:45.375; most accessible tissue: Callus, score: 82.874 N N N N
vg0604439758 C -> T LOC_Os06g08850.2 splice_region_variant&intron_variant ; LOW silent_mutation Average:45.375; most accessible tissue: Callus, score: 82.874 N N N N
vg0604439758 C -> T LOC_Os06g08860.1 downstream_gene_variant ; 3263.0bp to feature; MODIFIER silent_mutation Average:45.375; most accessible tissue: Callus, score: 82.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604439758 2.52E-07 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 7.23E-06 9.35E-17 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 5.65E-13 NA mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 5.92E-11 2.73E-21 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 8.95E-09 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 6.90E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 8.86E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 2.82E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 9.06E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 2.14E-10 NA mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 6.17E-10 7.27E-17 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 3.81E-06 2.50E-13 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 5.70E-07 NA mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 1.49E-06 7.25E-18 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 5.92E-16 NA mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 4.40E-14 4.66E-23 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 8.09E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 NA 6.71E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 4.26E-08 NA mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604439758 1.65E-07 2.66E-12 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251