\
| Variant ID: vg0604429481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4429481 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
GAAGAGGTAGAGAGGGAATTTGATGGATTCATTTTACTCAAGATTATCTTATTACAAGTCGTTATTTATTTATTTATTTTGAGATGTATTGATCTTTCTA[G/T]
AGCACAATTACTTCCCAGCTATGGCATCCAGGCTTTAGATTGCAGTGTACCCATCTACCTGACATCAATGGCCTCCAACCAAACACTAGACTTCAAGCAC
GTGCTTGAAGTCTAGTGTTTGGTTGGAGGCCATTGATGTCAGGTAGATGGGTACACTGCAATCTAAAGCCTGGATGCCATAGCTGGGAAGTAATTGTGCT[C/A]
TAGAAAGATCAATACATCTCAAAATAAATAAATAAATAACGACTTGTAATAAGATAATCTTGAGTAAAATGAATCCATCAAATTCCCTCTCTACCTCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.10% | 20.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.40% | 31.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604429481 | G -> T | LOC_Os06g08840.1 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.3 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.4 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.2 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.5 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.6 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.7 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| vg0604429481 | G -> T | LOC_Os06g08840.8 | intron_variant ; MODIFIER | silent_mutation | Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604429481 | 9.96E-06 | 2.28E-18 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604429481 | NA | 6.35E-12 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604429481 | 4.24E-11 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 2.11E-09 | NA | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 1.26E-10 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 1.19E-08 | 4.33E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 1.29E-16 | NA | mr1137_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 2.01E-11 | 1.05E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 3.11E-09 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | 8.90E-07 | 1.96E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604429481 | NA | 9.85E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |