\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604429481:

Variant ID: vg0604429481 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4429481
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGGTAGAGAGGGAATTTGATGGATTCATTTTACTCAAGATTATCTTATTACAAGTCGTTATTTATTTATTTATTTTGAGATGTATTGATCTTTCTA[G/T]
AGCACAATTACTTCCCAGCTATGGCATCCAGGCTTTAGATTGCAGTGTACCCATCTACCTGACATCAATGGCCTCCAACCAAACACTAGACTTCAAGCAC

Reverse complement sequence

GTGCTTGAAGTCTAGTGTTTGGTTGGAGGCCATTGATGTCAGGTAGATGGGTACACTGCAATCTAAAGCCTGGATGCCATAGCTGGGAAGTAATTGTGCT[C/A]
TAGAAAGATCAATACATCTCAAAATAAATAAATAAATAACGACTTGTAATAAGATAATCTTGAGTAAAATGAATCCATCAAATTCCCTCTCTACCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.10% 0.06% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 79.10% 20.70% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 68.40% 31.40% 0.13% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 80.10% 19.10% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604429481 G -> T LOC_Os06g08840.1 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.3 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.4 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.2 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.5 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.6 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.7 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N
vg0604429481 G -> T LOC_Os06g08840.8 intron_variant ; MODIFIER silent_mutation Average:69.1; most accessible tissue: Minghui63 flower, score: 81.266 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604429481 9.96E-06 2.28E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604429481 NA 6.35E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604429481 4.24E-11 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 2.11E-09 NA mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 1.26E-10 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 1.19E-08 4.33E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 1.29E-16 NA mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 2.01E-11 1.05E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 3.11E-09 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 8.90E-07 1.96E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604429481 NA 9.85E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251