Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604425979:

Variant ID: vg0604425979 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4425979
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTATCTCTCTCCATGAGAAGTTACGTTAAAAGCCAAATAGCTCTCAAAATAGCTATTGGATCCAAACAACTCAGAGTTATTTTATTGGAGGACTATTTA[C/T]
TTGTGCTAAAAAATAGCTCTCAAAATAACTCTTGGCTAGTTCTCTAAACAGGGCTATTAATTGATGGAGTCATACACCCACGACTTTATTCATGAGGCCA

Reverse complement sequence

TGGCCTCATGAATAAAGTCGTGGGTGTATGACTCCATCAATTAATAGCCCTGTTTAGAGAACTAGCCAAGAGTTATTTTGAGAGCTATTTTTTAGCACAA[G/A]
TAAATAGTCCTCCAATAAAATAACTCTGAGTTGTTTGGATCCAATAGCTATTTTGAGAGCTATTTGGCTTTTAACGTAACTTCTCATGGAGAGAGATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.70%	7.20%	0.87%	6.22%	NA
All Indica	2759	94.20%	0.50%	0.69%	4.60%	NA
All Japonica	1512	78.60%	21.00%	0.20%	0.20%	NA
Aus	269	34.60%	0.00%	7.06%	58.36%	NA
Indica I	595	90.40%	0.20%	0.50%	8.91%	NA
Indica II	465	97.40%	2.40%	0.00%	0.22%	NA
Indica III	913	98.40%	0.10%	0.99%	0.55%	NA
Indica Intermediate	786	90.20%	0.30%	0.89%	8.65%	NA
Temperate Japonica	767	68.40%	31.30%	0.26%	0.00%	NA
Tropical Japonica	504	94.60%	5.20%	0.00%	0.20%	NA
Japonica Intermediate	241	77.20%	21.60%	0.41%	0.83%	NA
VI/Aromatic	96	89.60%	5.20%	0.00%	5.21%	NA
Intermediate	90	93.30%	4.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604425979	C -> T	LOC_Os06g08840.1	upstream_gene_variant ; 2695.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.3	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.4	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.2	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.5	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.6	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.7	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08840.8	upstream_gene_variant ; 2687.0bp to feature; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> T	LOC_Os06g08830-LOC_Os06g08840	intergenic_region ; MODIFIER	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0604425979	C -> DEL	N	N	silent_mutation	Average:86.795; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0604425979	C	T	0.01	-0.01	0.0	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604425979	1.09E-06	9.61E-20	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604425979	NA	6.35E-12	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604425979	1.29E-11	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	2.11E-09	NA	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	1.30E-10	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	1.19E-08	4.33E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	3.60E-17	NA	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	2.01E-11	1.05E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	2.11E-09	NA	mr1617_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	8.90E-07	1.96E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604425979	NA	9.85E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251