Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604373917:

Variant ID: vg0604373917 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4373917
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

ATGACTACCTACTGTAGCAAATAATTGGCCATTAGGACAGGATATAGGATGTTTTAATGTTGCATTAACATCTCACAGTGGTGTACAATATAAACTATAG[T/C]
AAGTACTATGCTTACATAAGATCGGAAGTATTACATGCAAACAGCATCACCACAATGAGACTCAGAAACTAAGAATGTACCTCAACAAAAGAATGTTTCT

Reverse complement sequence

AGAAACATTCTTTTGTTGAGGTACATTCTTAGTTTCTGAGTCTCATTGTGGTGATGCTGTTTGCATGTAATACTTCCGATCTTATGTAAGCATAGTACTT[A/G]
CTATAGTTTATATTGTACACCACTGTGAGATGTTAATGCAACATTAAAACATCCTATATCCTGTCCTAATGGCCAATTATTTGCTACAGTAGGTAGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	7.70%	0.06%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.04%	0.00%	NA
All Japonica	1512	77.60%	22.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.60%	2.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	67.10%	32.90%	0.00%	0.00%	NA
Tropical Japonica	504	93.30%	6.50%	0.20%	0.00%	NA
Japonica Intermediate	241	78.40%	21.60%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	91.10%	7.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604373917	T -> C	LOC_Os06g08730.1	downstream_gene_variant ; 3064.0bp to feature; MODIFIER	silent_mutation	Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N
vg0604373917	T -> C	LOC_Os06g08740.1	intron_variant ; MODIFIER	silent_mutation	Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N
vg0604373917	T -> C	LOC_Os06g08740.2	intron_variant ; MODIFIER	silent_mutation	Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604373917	8.13E-07	4.14E-22	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604373917	NA	1.60E-12	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604373917	2.17E-13	NA	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	4.24E-11	4.94E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	5.43E-12	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	8.21E-10	5.84E-09	mr1617	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	NA	9.22E-06	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	3.23E-16	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	5.43E-11	1.36E-10	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	9.30E-09	NA	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	2.44E-06	3.07E-07	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917	NA	2.33E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251