\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604373917:

Variant ID: vg0604373917 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4373917
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ATGACTACCTACTGTAGCAAATAATTGGCCATTAGGACAGGATATAGGATGTTTTAATGTTGCATTAACATCTCACAGTGGTGTACAATATAAACTATAG[T/C]
AAGTACTATGCTTACATAAGATCGGAAGTATTACATGCAAACAGCATCACCACAATGAGACTCAGAAACTAAGAATGTACCTCAACAAAAGAATGTTTCT

Reverse complement sequence

AGAAACATTCTTTTGTTGAGGTACATTCTTAGTTTCTGAGTCTCATTGTGGTGATGCTGTTTGCATGTAATACTTCCGATCTTATGTAAGCATAGTACTT[A/G]
CTATAGTTTATATTGTACACCACTGTGAGATGTTAATGCAACATTAAAACATCCTATATCCTGTCCTAATGGCCAATTATTTGCTACAGTAGGTAGTCAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 7.70% 0.06% 0.00% NA
All Indica  2759 99.40% 0.50% 0.04% 0.00% NA
All Japonica  1512 77.60% 22.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.30% 0.13% 0.00% NA
Temperate Japonica  767 67.10% 32.90% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.50% 0.20% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604373917 T -> C LOC_Os06g08730.1 downstream_gene_variant ; 3064.0bp to feature; MODIFIER silent_mutation Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223 N N N N
vg0604373917 T -> C LOC_Os06g08740.1 intron_variant ; MODIFIER silent_mutation Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223 N N N N
vg0604373917 T -> C LOC_Os06g08740.2 intron_variant ; MODIFIER silent_mutation Average:57.622; most accessible tissue: Minghui63 flower, score: 69.223 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604373917 8.13E-07 4.14E-22 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604373917 NA 1.60E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604373917 2.17E-13 NA mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 4.24E-11 4.94E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 5.43E-12 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 8.21E-10 5.84E-09 mr1617 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 NA 9.22E-06 mr1707 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 3.23E-16 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 5.43E-11 1.36E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 9.30E-09 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 2.44E-06 3.07E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604373917 NA 2.33E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251