\
| Variant ID: vg0604336913 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4336913 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.02, others allele: 0.00, population size: 250. )
CTTTTAGTTAGCTCGGACCAAAGGTCCTAGCTCCTTTCTTTTTTCCTTTCGCTTTGTAAAGTTCTCCTTCTCTATTCAATGAAATTGGCGCTCGTTGATT[C/G]
GTTAAAAAAAACTGATTACTATCGTTTTAAGAAGTTATAGTAATAAATCACAGTCCATTAATGCTTCTCATAGACAAAGCTAATATAACTGGTACGAAAC
GTTTCGTACCAGTTATATTAGCTTTGTCTATGAGAAGCATTAATGGACTGTGATTTATTACTATAACTTCTTAAAACGATAGTAATCAGTTTTTTTTAAC[G/C]
AATCAACGAGCGCCAATTTCATTGAATAGAGAAGGAGAACTTTACAAAGCGAAAGGAAAAAAGAAAGGAGCTAGGACCTTTGGTCCGAGCTAACTAAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.80% | 48.70% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 18.20% | 81.00% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 98.50% | 1.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.50% | 78.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 34.40% | 65.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 2.50% | 96.60% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 24.30% | 74.70% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604336913 | C -> G | LOC_Os06g08690.1 | upstream_gene_variant ; 2107.0bp to feature; MODIFIER | silent_mutation | Average:29.893; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0604336913 | C -> G | LOC_Os06g08700.1 | downstream_gene_variant ; 90.0bp to feature; MODIFIER | silent_mutation | Average:29.893; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0604336913 | C -> G | LOC_Os06g08710.1 | downstream_gene_variant ; 2394.0bp to feature; MODIFIER | silent_mutation | Average:29.893; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0604336913 | C -> G | LOC_Os06g08700-LOC_Os06g08710 | intergenic_region ; MODIFIER | silent_mutation | Average:29.893; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604336913 | NA | 2.30E-14 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336913 | NA | 2.94E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336913 | NA | 4.03E-07 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336913 | NA | 8.33E-14 | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336913 | NA | 5.74E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |