\
| Variant ID: vg0604336775 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4336775 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
CCTGGAAGATATGGAACGAAAGGAATCGTAGAACCTTCCAACAGAAGGAGCTTTCAGCTACCTCCCTTTTAGCCAAGATTAAGGAAGAGGCCAAAACTTG[G/A]
GTCTTAGCAGGAGCGATAAGTCTTAATAGCTGGCTTTCTTTTAGTTAGCTCGGACCAAAGGTCCTAGCTCCTTTCTTTTTTCCTTTCGCTTTGTAAAGTT
AACTTTACAAAGCGAAAGGAAAAAAGAAAGGAGCTAGGACCTTTGGTCCGAGCTAACTAAAAGAAAGCCAGCTATTAAGACTTATCGCTCCTGCTAAGAC[C/T]
CAAGTTTTGGCCTCTTCCTTAATCTTGGCTAAAAGGGAGGTAGCTGAAAGCTCCTTCTGTTGGAAGGTTCTACGATTCCTTTCGTTCCATATCTTCCAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 7.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.80% | 21.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.70% | 31.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.30% | 20.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604336775 | G -> A | LOC_Os06g08700.1 | stop_gained ; p.Trp170*; HIGH | stop_gained | Average:34.828; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604336775 | NA | 2.29E-19 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604336775 | NA | 3.84E-12 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604336775 | 6.64E-13 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 2.21E-10 | 8.58E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 4.27E-12 | NA | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 1.74E-09 | 6.53E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 4.20E-16 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 9.60E-11 | 1.78E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 1.19E-08 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | 3.42E-06 | 4.20E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604336775 | NA | 1.60E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |