Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604325297:

Variant ID: vg0604325297 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4325297
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TATCCGTTGTTGTGGGTGTCGTCAGAATCTACTTTGAGGCGCATATATCATCACTTTTTTTAGATAAGGGCATTTTTTTACCTGGCCTCTACATCCAACC[A/C]
TATATATCATCACTATGTCATCATTTTTGCTCTATCATACTCCCTCTGTGTCAAAATAAATTAACCCTCGTATTAGGATGTGACAACAAATCTGGACATA

Reverse complement sequence

TATGTCCAGATTTGTTGTCACATCCTAATACGAGGGTTAATTTATTTTGACACAGAGGGAGTATGATAGAGCAAAAATGATGACATAGTGATGATATATA[T/G]
GGTTGGATGTAGAGGCCAGGTAAAAAAATGCCCTTATCTAAAAAAAGTGATGATATATGCGCCTCAAAGTAGATTCTGACGACACCCACAACAACGGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.20%	22.80%	3.47%	47.52%	NA
All Indica	2759	35.00%	5.70%	4.64%	54.66%	NA
All Japonica	1512	7.20%	58.90%	1.19%	32.74%	NA
Aus	269	48.30%	1.10%	2.23%	48.33%	NA
Indica I	595	42.70%	0.30%	8.07%	48.91%	NA
Indica II	465	26.20%	11.60%	3.87%	58.28%	NA
Indica III	913	35.60%	3.30%	2.30%	58.82%	NA
Indica Intermediate	786	33.80%	8.90%	5.22%	52.04%	NA
Temperate Japonica	767	1.20%	95.40%	0.26%	3.13%	NA
Tropical Japonica	504	14.50%	8.90%	2.58%	74.01%	NA
Japonica Intermediate	241	11.20%	46.90%	1.24%	40.66%	NA
VI/Aromatic	96	18.80%	13.50%	7.29%	60.42%	NA
Intermediate	90	17.80%	15.60%	5.56%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604325297	A -> C	LOC_Os06g08680.1	upstream_gene_variant ; 4369.0bp to feature; MODIFIER	silent_mutation	Average:58.789; most accessible tissue: Callus, score: 87.637	N	N	N	N
vg0604325297	A -> C	LOC_Os06g08670.1	downstream_gene_variant ; 14.0bp to feature; MODIFIER	silent_mutation	Average:58.789; most accessible tissue: Callus, score: 87.637	N	N	N	N
vg0604325297	A -> C	LOC_Os06g08670-LOC_Os06g08680	intergenic_region ; MODIFIER	silent_mutation	Average:58.789; most accessible tissue: Callus, score: 87.637	N	N	N	N
vg0604325297	A -> DEL	N	N	silent_mutation	Average:58.789; most accessible tissue: Callus, score: 87.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604325297	1.06E-07	1.61E-26	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	2.23E-08	3.35E-23	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	6.95E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	1.88E-06	NA	mr1241	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	3.83E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	9.79E-08	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	2.74E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	1.29E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	3.28E-14	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	2.51E-06	2.51E-06	mr1831	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	3.65E-07	1.55E-25	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	7.89E-14	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	1.38E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	7.29E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	2.55E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	1.41E-07	1.40E-30	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	4.70E-08	4.44E-23	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	1.55E-10	1.08E-63	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	1.66E-06	2.78E-18	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	2.38E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	1.96E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	6.73E-06	1.60E-26	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	4.95E-15	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	3.02E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	3.51E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	3.15E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297	NA	4.55E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251