\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604325297:

Variant ID: vg0604325297 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4325297
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCGTTGTTGTGGGTGTCGTCAGAATCTACTTTGAGGCGCATATATCATCACTTTTTTTAGATAAGGGCATTTTTTTACCTGGCCTCTACATCCAACC[A/C]
TATATATCATCACTATGTCATCATTTTTGCTCTATCATACTCCCTCTGTGTCAAAATAAATTAACCCTCGTATTAGGATGTGACAACAAATCTGGACATA

Reverse complement sequence

TATGTCCAGATTTGTTGTCACATCCTAATACGAGGGTTAATTTATTTTGACACAGAGGGAGTATGATAGAGCAAAAATGATGACATAGTGATGATATATA[T/G]
GGTTGGATGTAGAGGCCAGGTAAAAAAATGCCCTTATCTAAAAAAAGTGATGATATATGCGCCTCAAAGTAGATTCTGACGACACCCACAACAACGGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.20% 22.80% 3.47% 47.52% NA
All Indica  2759 35.00% 5.70% 4.64% 54.66% NA
All Japonica  1512 7.20% 58.90% 1.19% 32.74% NA
Aus  269 48.30% 1.10% 2.23% 48.33% NA
Indica I  595 42.70% 0.30% 8.07% 48.91% NA
Indica II  465 26.20% 11.60% 3.87% 58.28% NA
Indica III  913 35.60% 3.30% 2.30% 58.82% NA
Indica Intermediate  786 33.80% 8.90% 5.22% 52.04% NA
Temperate Japonica  767 1.20% 95.40% 0.26% 3.13% NA
Tropical Japonica  504 14.50% 8.90% 2.58% 74.01% NA
Japonica Intermediate  241 11.20% 46.90% 1.24% 40.66% NA
VI/Aromatic  96 18.80% 13.50% 7.29% 60.42% NA
Intermediate  90 17.80% 15.60% 5.56% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604325297 A -> C LOC_Os06g08680.1 upstream_gene_variant ; 4369.0bp to feature; MODIFIER silent_mutation Average:58.789; most accessible tissue: Callus, score: 87.637 N N N N
vg0604325297 A -> C LOC_Os06g08670.1 downstream_gene_variant ; 14.0bp to feature; MODIFIER silent_mutation Average:58.789; most accessible tissue: Callus, score: 87.637 N N N N
vg0604325297 A -> C LOC_Os06g08670-LOC_Os06g08680 intergenic_region ; MODIFIER silent_mutation Average:58.789; most accessible tissue: Callus, score: 87.637 N N N N
vg0604325297 A -> DEL N N silent_mutation Average:58.789; most accessible tissue: Callus, score: 87.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604325297 1.06E-07 1.61E-26 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 2.23E-08 3.35E-23 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 6.95E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 1.88E-06 NA mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 3.83E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 9.79E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 2.74E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 1.29E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 3.28E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 2.51E-06 2.51E-06 mr1831 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 3.65E-07 1.55E-25 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 7.89E-14 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 1.38E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 7.29E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 2.55E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 1.41E-07 1.40E-30 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 4.70E-08 4.44E-23 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 1.55E-10 1.08E-63 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 1.66E-06 2.78E-18 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 2.38E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 1.96E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 6.73E-06 1.60E-26 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 4.95E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 3.02E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 3.51E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 3.15E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604325297 NA 4.55E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251