\
| Variant ID: vg0604317901 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4317901 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )
TGAAGATTCTCCGAGCTTCAGAAATGCTTCCACATTTTGCATACATGTCGATGAGCGCTGTCATGACATAGACATTGGGCTCCAAGTCCTCCTCAGTGAT[A/G]
ATCCTGTGCAGCCACTTCCCCAGGGACAAAGCTCCAAGCTGTGCACATGCGGAAAGAGTGCTTGAGATTGTGATTGGATTCGGTCGCACATTAAGCTTCA
TGAAGCTTAATGTGCGACCGAATCCAATCACAATCTCAAGCACTCTTTCCGCATGTGCACAGCTTGGAGCTTTGTCCCTGGGGAAGTGGCTGCACAGGAT[T/C]
ATCACTGAGGAGGACTTGGAGCCCAATGTCTATGTCATGACAGCGCTCATCGACATGTATGCAAAATGTGGAAGCATTTCTGAAGCTCGGAGAATCTTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 10.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604317901 | A -> G | LOC_Os06g08660.1 | synonymous_variant ; p.Ile439Ile; LOW | nonsynonymous_codon ; I439V | Average:63.4; most accessible tissue: Minghui63 flag leaf, score: 81.312 | benign |
0.239 |
TOLERATED | 0.08 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604317901 | NA | 7.06E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604317901 | 4.12E-11 | NA | mr1137 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 1.73E-09 | 4.30E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | NA | 3.38E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | NA | 3.92E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 3.04E-06 | NA | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | NA | 1.94E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 5.29E-10 | NA | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 7.40E-09 | 3.14E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | NA | 9.44E-06 | mr1707 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 4.49E-13 | NA | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 4.13E-09 | 2.15E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | 1.24E-06 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604317901 | NA | 1.61E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |