\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604311698:

Variant ID: vg0604311698 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 4311698
Reference Allele: TAlternative Allele: A,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTAATTGTTTGTTACAATAATTGATTACTCTATTTCCCCACGCAATTGAGGTGGACAAGAAGGGATGAGGTAAACTTTTACCAGCGCATAAATAAAT[T/A,TA]
AAAAAAATGCTGGTTTAAACTTCTCAACTTTTAGCGTAGTTAAATTTCCTTTCTAAACTTAAGATAGAGCCAAATTTGAATTTTAAAATTATTTTAGATA

Reverse complement sequence

TATCTAAAATAATTTTAAAATTCAAATTTGGCTCTATCTTAAGTTTAGAAAGGAAATTTAACTACGCTAAAAGTTGAGAAGTTTAAACCAGCATTTTTTT[A/T,TA]
ATTTATTTATGCGCTGGTAAAAGTTTACCTCATCCCTTCTTGTCCACCTCAATTGCGTGGGGAAATAGAGTAATCAATTATTGTAACAAACAATTAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 19.80% 0.08% 7.02% TA: 12.00%
All Indica  2759 74.50% 1.10% 0.11% 11.63% TA: 12.72%
All Japonica  1512 40.30% 58.80% 0.07% 0.33% TA: 0.46%
Aus  269 28.60% 0.00% 0.00% 0.00% TA: 71.38%
Indica I  595 73.80% 0.30% 0.17% 3.70% TA: 22.02%
Indica II  465 87.70% 2.40% 0.00% 0.43% TA: 9.46%
Indica III  913 68.10% 0.90% 0.11% 27.60% TA: 3.29%
Indica Intermediate  786 74.60% 1.00% 0.13% 5.73% TA: 18.58%
Temperate Japonica  767 4.40% 95.30% 0.00% 0.13% TA: 0.13%
Tropical Japonica  504 89.70% 9.50% 0.00% 0.60% TA: 0.20%
Japonica Intermediate  241 51.50% 45.60% 0.41% 0.41% TA: 2.07%
VI/Aromatic  96 83.30% 7.30% 0.00% 0.00% TA: 9.38%
Intermediate  90 73.30% 11.10% 0.00% 6.67% TA: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604311698 T -> A LOC_Os06g08650.1 upstream_gene_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> A LOC_Os06g08660.1 downstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> A LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> DEL N N silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> TA LOC_Os06g08650.1 upstream_gene_variant ; 1613.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> TA LOC_Os06g08660.1 downstream_gene_variant ; 3994.0bp to feature; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N
vg0604311698 T -> TA LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:40.395; most accessible tissue: Minghui63 root, score: 79.954 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604311698 2.37E-06 1.83E-20 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 1.76E-07 NA mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.52E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 7.80E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 1.41E-06 1.41E-06 mr1582 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 1.29E-06 7.97E-07 mr1582 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 7.73E-07 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 9.27E-06 1.67E-22 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 1.16E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 9.03E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.56E-07 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 6.98E-06 2.37E-06 mr1772 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 7.84E-08 3.29E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.65E-06 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.13E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 3.36E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 6.85E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 7.99E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 2.86E-07 5.54E-22 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 4.61E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 5.71E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 2.47E-08 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 1.34E-16 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.20E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 5.50E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.74E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.21E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 9.14E-06 NA mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 7.81E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 5.54E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 1.56E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 1.91E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604311698 NA 2.20E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251