\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604308260:

Variant ID: vg0604308260 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4308260
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATCATGTTTTATCATCTAACAATAATAAAAATACGAATTATAAAAAAATTTCATATAAGACGGATAGTCAAAGTTGGACACGCAAACCCAAGGTTTG[T/C,A]
CTTTTTTTTTGGGGACGGATGGAGTAGGTGGCTAGTATAATACTCATTCTTTATAATAAGGTCTCTCCTAGAACTAATAAGACAGTATTAAAAGTTCACA

Reverse complement sequence

TGTGAACTTTTAATACTGTCTTATTAGTTCTAGGAGAGACCTTATTATAAAGAATGAGTATTATACTAGCCACCTACTCCATCCGTCCCCAAAAAAAAAG[A/G,T]
CAAACCTTGGGTTTGCGTGTCCAACTTTGACTATCCGTCTTATATGAAATTTTTTTATAATTCGTATTTTTATTATTGTTAGATGATAAAACATGATTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 19.50% 19.10% 18.28% 43.08% A: 0.04%
All Indica  2759 10.10% 12.90% 25.55% 51.40% A: 0.04%
All Japonica  1512 40.50% 22.70% 6.68% 30.09% A: 0.07%
Aus  269 2.60% 66.50% 7.81% 23.05% NA
Indica I  595 3.40% 21.50% 28.40% 46.72% NA
Indica II  465 10.30% 11.40% 28.17% 50.11% NA
Indica III  913 15.00% 3.50% 25.96% 55.53% NA
Indica Intermediate  786 9.50% 18.10% 21.37% 50.89% A: 0.13%
Temperate Japonica  767 61.90% 33.20% 1.04% 3.78% NA
Tropical Japonica  504 13.10% 6.30% 14.09% 66.47% NA
Japonica Intermediate  241 29.50% 23.20% 9.13% 37.76% A: 0.41%
VI/Aromatic  96 5.20% 15.60% 18.75% 60.42% NA
Intermediate  90 18.90% 12.20% 21.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604308260 T -> C LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:40.638; most accessible tissue: Callus, score: 92.867 N N N N
vg0604308260 T -> A LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:40.638; most accessible tissue: Callus, score: 92.867 N N N N
vg0604308260 T -> DEL N N silent_mutation Average:40.638; most accessible tissue: Callus, score: 92.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604308260 9.96E-11 6.69E-27 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 2.01E-10 4.56E-20 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 1.17E-19 3.43E-49 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 2.27E-18 5.06E-33 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 NA 1.52E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 NA 1.57E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 NA 3.42E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 NA 7.13E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 3.19E-06 NA mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 2.13E-06 8.55E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 6.93E-16 1.07E-39 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 1.76E-14 2.33E-24 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 1.20E-09 1.52E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 3.46E-08 1.49E-14 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 4.30E-09 1.21E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 1.03E-10 9.91E-20 mr1115_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 9.97E-20 2.35E-52 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 8.37E-20 1.40E-33 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 2.34E-06 NA mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 7.44E-08 1.43E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 1.81E-10 3.22E-31 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604308260 4.04E-10 1.79E-17 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251