Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604305997:

Variant ID: vg0604305997 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4305997
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AGAATTGATACTCTCTCTGTATTTTAATATATGAAGCCATTAACTTTTTGATTAACGTTTGACTATTCGTCTTATTCAAAATTTTTGTGTAAATATAAAA[A/T]
TATTTATGTCATGCTTAAAGAACATTTGATGATCAATCAAGTCACAATAAAATAAATGATAATTACATAAATTTTTTGAATAAAACGAAATGTTAAACGT

Reverse complement sequence

ACGTTTAACATTTCGTTTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTGATCATCAAATGTTCTTTAAGCATGACATAAATA[T/A]
TTTTATATTTACACAAAAATTTTGAATAAGACGAATAGTCAAACGTTAATCAAAAAGTTAATGGCTTCATATATTAAAATACAGAGAGAGTATCAATTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.10%	3.20%	3.20%	61.53%	NA
All Indica	2759	14.30%	4.70%	3.95%	77.02%	NA
All Japonica	1512	59.30%	0.50%	1.26%	38.96%	NA
Aus	269	71.40%	1.90%	6.69%	20.07%	NA
Indica I	595	23.20%	0.20%	0.17%	76.47%	NA
Indica II	465	12.70%	0.40%	1.29%	85.59%	NA
Indica III	913	3.70%	12.70%	9.20%	74.37%	NA
Indica Intermediate	786	20.70%	1.50%	2.29%	75.45%	NA
Temperate Japonica	767	95.80%	0.00%	0.13%	4.04%	NA
Tropical Japonica	504	9.10%	1.00%	2.78%	87.10%	NA
Japonica Intermediate	241	48.10%	0.80%	1.66%	49.38%	NA
VI/Aromatic	96	17.70%	3.10%	1.04%	78.12%	NA
Intermediate	90	18.90%	4.40%	4.44%	72.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604305997	A -> T	LOC_Os06g08640.1	upstream_gene_variant ; 2876.0bp to feature; MODIFIER	silent_mutation	Average:28.362; most accessible tissue: Callus, score: 58.933	N	N	N	N
vg0604305997	A -> T	LOC_Os06g08640-LOC_Os06g08650	intergenic_region ; MODIFIER	silent_mutation	Average:28.362; most accessible tissue: Callus, score: 58.933	N	N	N	N
vg0604305997	A -> DEL	N	N	silent_mutation	Average:28.362; most accessible tissue: Callus, score: 58.933	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604305997	2.23E-08	3.35E-23	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	6.95E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	3.83E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	2.74E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	6.01E-23	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	3.28E-14	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	2.08E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	4.12E-06	3.21E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	7.89E-14	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	1.38E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	7.29E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	2.55E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	4.70E-08	4.44E-23	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	4.95E-06	4.95E-06	mr1173_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	7.29E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	7.65E-07	NA	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	1.66E-06	2.78E-18	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	2.38E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	1.96E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	1.53E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	4.95E-15	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	3.02E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	3.51E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	3.15E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997	NA	4.55E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251