\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604305997:

Variant ID: vg0604305997 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4305997
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATTGATACTCTCTCTGTATTTTAATATATGAAGCCATTAACTTTTTGATTAACGTTTGACTATTCGTCTTATTCAAAATTTTTGTGTAAATATAAAA[A/T]
TATTTATGTCATGCTTAAAGAACATTTGATGATCAATCAAGTCACAATAAAATAAATGATAATTACATAAATTTTTTGAATAAAACGAAATGTTAAACGT

Reverse complement sequence

ACGTTTAACATTTCGTTTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTGATCATCAAATGTTCTTTAAGCATGACATAAATA[T/A]
TTTTATATTTACACAAAAATTTTGAATAAGACGAATAGTCAAACGTTAATCAAAAAGTTAATGGCTTCATATATTAAAATACAGAGAGAGTATCAATTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.10% 3.20% 3.20% 61.53% NA
All Indica  2759 14.30% 4.70% 3.95% 77.02% NA
All Japonica  1512 59.30% 0.50% 1.26% 38.96% NA
Aus  269 71.40% 1.90% 6.69% 20.07% NA
Indica I  595 23.20% 0.20% 0.17% 76.47% NA
Indica II  465 12.70% 0.40% 1.29% 85.59% NA
Indica III  913 3.70% 12.70% 9.20% 74.37% NA
Indica Intermediate  786 20.70% 1.50% 2.29% 75.45% NA
Temperate Japonica  767 95.80% 0.00% 0.13% 4.04% NA
Tropical Japonica  504 9.10% 1.00% 2.78% 87.10% NA
Japonica Intermediate  241 48.10% 0.80% 1.66% 49.38% NA
VI/Aromatic  96 17.70% 3.10% 1.04% 78.12% NA
Intermediate  90 18.90% 4.40% 4.44% 72.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604305997 A -> T LOC_Os06g08640.1 upstream_gene_variant ; 2876.0bp to feature; MODIFIER silent_mutation Average:28.362; most accessible tissue: Callus, score: 58.933 N N N N
vg0604305997 A -> T LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:28.362; most accessible tissue: Callus, score: 58.933 N N N N
vg0604305997 A -> DEL N N silent_mutation Average:28.362; most accessible tissue: Callus, score: 58.933 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604305997 2.23E-08 3.35E-23 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 6.95E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 3.83E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 2.74E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 6.01E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 3.28E-14 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 2.08E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 4.12E-06 3.21E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 7.89E-14 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 1.38E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 7.29E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 2.55E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 4.70E-08 4.44E-23 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 4.95E-06 4.95E-06 mr1173_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 7.29E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 7.65E-07 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 1.66E-06 2.78E-18 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 2.38E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 1.96E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 1.53E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 4.95E-15 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 3.02E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 3.51E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 3.15E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305997 NA 4.55E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251