Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604305985:

Variant ID: vg0604305985 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4305985
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTACTGAACAAAGAATTGATACTCTCTCTGTATTTTAATATATGAAGCCATTAACTTTTTGATTAACGTTTGACTATTCGTCTTATTCAAAATTTTTGT[G/A]
TAAATATAAAAATATTTATGTCATGCTTAAAGAACATTTGATGATCAATCAAGTCACAATAAAATAAATGATAATTACATAAATTTTTTGAATAAAACGA

Reverse complement sequence

TCGTTTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTGATTGATCATCAAATGTTCTTTAAGCATGACATAAATATTTTTATATTTA[C/T]
ACAAAAATTTTGAATAAGACGAATAGTCAAACGTTAATCAAAAAGTTAATGGCTTCATATATTAAAATACAGAGAGAGTATCAATTCTTTGTTCAGTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.00%	0.50%	1.23%	58.27%	NA
All Indica	2759	27.20%	0.40%	0.69%	71.73%	NA
All Japonica	1512	59.70%	0.50%	0.79%	39.02%	NA
Aus	269	71.70%	1.10%	8.92%	18.22%	NA
Indica I	595	26.70%	0.20%	0.34%	72.77%	NA
Indica II	465	13.50%	0.60%	0.22%	85.59%	NA
Indica III	913	35.20%	0.30%	0.44%	64.07%	NA
Indica Intermediate	786	26.30%	0.50%	1.53%	71.63%	NA
Temperate Japonica	767	95.70%	0.00%	0.26%	4.04%	NA
Tropical Japonica	504	10.30%	1.00%	1.59%	87.10%	NA
Japonica Intermediate	241	48.50%	0.80%	0.83%	49.79%	NA
VI/Aromatic	96	17.70%	3.10%	2.08%	77.08%	NA
Intermediate	90	30.00%	0.00%	1.11%	68.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604305985	G -> A	LOC_Os06g08640.1	upstream_gene_variant ; 2864.0bp to feature; MODIFIER	silent_mutation	Average:29.628; most accessible tissue: Callus, score: 58.933	N	N	N	N
vg0604305985	G -> A	LOC_Os06g08640-LOC_Os06g08650	intergenic_region ; MODIFIER	silent_mutation	Average:29.628; most accessible tissue: Callus, score: 58.933	N	N	N	N
vg0604305985	G -> DEL	N	N	silent_mutation	Average:29.628; most accessible tissue: Callus, score: 58.933	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604305985	2.23E-08	3.35E-23	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	6.95E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	3.83E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	1.10E-06	1.10E-06	mr1582	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	6.91E-06	5.74E-06	mr1582	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	2.74E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	3.28E-14	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	4.50E-07	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	8.40E-06	mr1772	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	7.89E-14	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	1.38E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	7.29E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	2.55E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	4.70E-08	4.44E-23	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	7.29E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	6.48E-06	NA	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	1.66E-06	2.78E-18	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	2.38E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	1.96E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	1.83E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	4.95E-15	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	3.02E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	3.51E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	3.15E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604305985	NA	4.55E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251