\
| Variant ID: vg0604304747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4304747 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
ACTAATTTGAATGAGAGGATCTTAGCAAATTATTGTCTTAACAAATTAATTCCCATATTAGCTCTTATGGTGCTAGCTGGTAATACCTCTGGTCTTTTTC[G/A]
AAAAGCTCGATATATATGAGAGGAGGAGCTCACATGTTGATGTTTACTAATGCTATTCTCGGTTCCGTGGGTTGGGAACTAACACTCCTGCACACGCAAA
TTTGCGTGTGCAGGAGTGTTAGTTCCCAACCCACGGAACCGAGAATAGCATTAGTAAACATCAACATGTGAGCTCCTCCTCTCATATATATCGAGCTTTT[C/T]
GAAAAAGACCAGAGGTATTACCAGCTAGCACCATAAGAGCTAATATGGGAATTAATTTGTTAAGACAATAATTTGCTAAGATCCTCTCATTCAAATTAGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.40% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 86.30% | 13.30% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 40.70% | 59.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 28.30% | 71.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 77.30% | 21.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 19.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 4.40% | 95.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 47.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604304747 | G -> A | LOC_Os06g08640.1 | upstream_gene_variant ; 1626.0bp to feature; MODIFIER | silent_mutation | Average:35.563; most accessible tissue: Callus, score: 80.35 | N | N | N | N |
| vg0604304747 | G -> A | LOC_Os06g08640-LOC_Os06g08650 | intergenic_region ; MODIFIER | silent_mutation | Average:35.563; most accessible tissue: Callus, score: 80.35 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604304747 | 8.34E-06 | NA | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 2.78E-09 | 8.30E-24 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 7.35E-09 | NA | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 1.02E-12 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 5.50E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 2.27E-08 | 1.28E-28 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 3.59E-06 | mr1611 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 9.16E-16 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 8.13E-07 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 6.54E-10 | 4.39E-29 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 2.12E-06 | 9.64E-09 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 1.33E-14 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 2.59E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 1.80E-09 | 2.03E-24 | mr1115_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 3.98E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 1.07E-09 | NA | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 4.88E-08 | 6.24E-20 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 2.76E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | 1.05E-06 | 9.78E-17 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 3.75E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604304747 | NA | 9.07E-07 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |