\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604303918:

Variant ID: vg0604303918 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4303918
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.21, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGATAAATTATACCAAATACTTTTGTGTTAGGCTCGGTGAGGCCCACTATATATCAAGTCTTATACAGAATCAAGTCAGCTTATATATAGAAGGTGTTCC[A/G]
GATAAAGAAGGAGAAACATAGTCCTAGGACTACTTGGATAGTTTTTACATACCTGTTTCCCTAGTTTTACTTGGATAGGAGGGTACTTAAGGGTATAAAT

Reverse complement sequence

ATTTATACCCTTAAGTACCCTCCTATCCAAGTAAAACTAGGGAAACAGGTATGTAAAAACTATCCAAGTAGTCCTAGGACTATGTTTCTCCTTCTTTATC[T/C]
GGAACACCTTCTATATATAAGCTGACTTGATTCTGTATAAGACTTGATATATAGTGGGCCTCACCGAGCCTAACACAAAAGTATTTGGTATAATTTATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 19.10% 0.40% 2.20% NA
All Indica  2759 85.70% 12.90% 0.25% 1.09% NA
All Japonica  1512 77.20% 22.10% 0.33% 0.40% NA
Aus  269 2.20% 70.60% 2.60% 24.54% NA
Indica I  595 78.30% 21.50% 0.17% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 95.50% 3.40% 0.11% 0.99% NA
Indica Intermediate  786 78.40% 18.30% 0.64% 2.67% NA
Temperate Japonica  767 67.30% 32.20% 0.39% 0.13% NA
Tropical Japonica  504 93.30% 6.30% 0.00% 0.40% NA
Japonica Intermediate  241 75.10% 22.80% 0.83% 1.24% NA
VI/Aromatic  96 85.40% 13.50% 0.00% 1.04% NA
Intermediate  90 86.70% 12.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604303918 A -> G LOC_Os06g08640.1 upstream_gene_variant ; 797.0bp to feature; MODIFIER silent_mutation Average:32.251; most accessible tissue: Callus, score: 68.203 N N N N
vg0604303918 A -> G LOC_Os06g08640-LOC_Os06g08650 intergenic_region ; MODIFIER silent_mutation Average:32.251; most accessible tissue: Callus, score: 68.203 N N N N
vg0604303918 A -> DEL N N silent_mutation Average:32.251; most accessible tissue: Callus, score: 68.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604303918 NA 5.07E-12 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604303918 1.73E-08 NA mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 7.75E-10 NA mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 NA 2.35E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 6.22E-07 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 7.83E-09 1.03E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 3.73E-06 2.40E-08 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 8.13E-14 NA mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 1.85E-10 1.31E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 1.75E-07 NA mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 6.17E-06 3.34E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604303918 NA 2.25E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251