Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604300121:

Variant ID: vg0604300121 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4300121
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATTTTTGGACCGAATATTTTGCTAGCCGGTGTCTGGTGACATTTTGCCCACTTTTTTTTTTTTGAGAAGACATTTTGCCCACTTCAACCAGGCTTCCT[A/T]
AGTTCCTAGGCTCCTGACCATGGACTGGCCGAGTATTTGGTCCATTTCTAGGAGTATGCAAAACATAGAAAAAGTATCCAGATTACGTCTCTTAACTACG

Reverse complement sequence

CGTAGTTAAGAGACGTAATCTGGATACTTTTTCTATGTTTTGCATACTCCTAGAAATGGACCAAATACTCGGCCAGTCCATGGTCAGGAGCCTAGGAACT[T/A]
AGGAAGCCTGGTTGAAGTGGGCAAAATGTCTTCTCAAAAAAAAAAAAGTGGGCAAAATGTCACCAGACACCGGCTAGCAAAATATTCGGTCCAAAAATAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.50%	0.80%	1.50%	50.19%	NA
All Indica	2759	35.40%	0.90%	1.92%	61.83%	NA
All Japonica	1512	62.60%	0.60%	1.06%	35.71%	NA
Aus	269	98.90%	0.00%	0.00%	1.12%	NA
Indica I	595	29.10%	0.80%	1.85%	68.24%	NA
Indica II	465	21.70%	1.70%	1.94%	74.62%	NA
Indica III	913	45.90%	0.50%	1.42%	52.14%	NA
Indica Intermediate	786	36.00%	0.80%	2.54%	60.69%	NA
Temperate Japonica	767	96.30%	0.00%	0.13%	3.52%	NA
Tropical Japonica	504	17.10%	1.40%	2.38%	79.17%	NA
Japonica Intermediate	241	50.60%	0.80%	1.24%	47.30%	NA
VI/Aromatic	96	27.10%	2.10%	2.08%	68.75%	NA
Intermediate	90	35.60%	1.10%	0.00%	63.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604300121	A -> T	LOC_Os06g08640.1	downstream_gene_variant ; 1436.0bp to feature; MODIFIER	silent_mutation	Average:34.093; most accessible tissue: Callus, score: 61.007	N	N	N	N
vg0604300121	A -> T	LOC_Os06g08630-LOC_Os06g08640	intergenic_region ; MODIFIER	silent_mutation	Average:34.093; most accessible tissue: Callus, score: 61.007	N	N	N	N
vg0604300121	A -> DEL	N	N	silent_mutation	Average:34.093; most accessible tissue: Callus, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604300121	NA	1.44E-15	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	3.39E-06	3.39E-06	mr1582	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	5.68E-07	1.42E-07	mr1582	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	8.06E-06	1.56E-08	mr1772	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	7.11E-08	1.23E-08	mr1772	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	2.24E-06	1.08E-21	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	5.88E-06	mr1920	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	2.18E-06	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	5.59E-07	2.57E-19	mr1115_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	8.63E-13	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	7.60E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	5.79E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604300121	NA	5.36E-13	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251