\
| Variant ID: vg0604288046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4288046 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.16, others allele: 0.00, population size: 82. )
ATAGAGGGAGAAACGCTAGCGCCGACGGCGTGGAACCGGCTCCTTGACTTAGCTCGTTCTAAGTCAGAGGTGTACAGTAATCTGCGTCACGTGCTACAGT[T/G]
CCTCTGACGTAACACTGTAGCAACAGTGCGAAACAGTGAAAAATATGGTTTAGAGTTGCTGTTTGGAAAATACTATTCACGGTACTGTATCGATCTGTTC
GAACAGATCGATACAGTACCGTGAATAGTATTTTCCAAACAGCAACTCTAAACCATATTTTTCACTGTTTCGCACTGTTGCTACAGTGTTACGTCAGAGG[A/C]
ACTGTAGCACGTGACGCAGATTACTGTACACCTCTGACTTAGAACGAGCTAAGTCAAGGAGCCGGTTCCACGCCGTCGGCGCTAGCGTTTCTCCCTCTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.00% | 12.40% | 0.28% | 60.39% | NA |
| All Indica | 2759 | 25.10% | 0.80% | 0.25% | 73.83% | NA |
| All Japonica | 1512 | 23.40% | 36.70% | 0.07% | 39.81% | NA |
| Aus | 269 | 71.40% | 0.00% | 0.37% | 28.25% | NA |
| Indica I | 595 | 22.40% | 0.70% | 0.00% | 76.97% | NA |
| Indica II | 465 | 12.70% | 0.40% | 0.22% | 86.67% | NA |
| Indica III | 913 | 34.40% | 0.30% | 0.44% | 64.84% | NA |
| Indica Intermediate | 786 | 23.80% | 1.70% | 0.25% | 74.30% | NA |
| Temperate Japonica | 767 | 33.10% | 62.80% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 7.90% | 3.20% | 0.00% | 88.89% | NA |
| Japonica Intermediate | 241 | 24.90% | 23.70% | 0.00% | 51.45% | NA |
| VI/Aromatic | 96 | 17.70% | 0.00% | 1.04% | 81.25% | NA |
| Intermediate | 90 | 21.10% | 7.80% | 3.33% | 67.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604288046 | T -> G | LOC_Os06g08620.1 | upstream_gene_variant ; 338.0bp to feature; MODIFIER | silent_mutation | Average:15.735; most accessible tissue: Callus, score: 99.915 | N | N | N | N |
| vg0604288046 | T -> G | LOC_Os06g08610.1 | downstream_gene_variant ; 156.0bp to feature; MODIFIER | silent_mutation | Average:15.735; most accessible tissue: Callus, score: 99.915 | N | N | N | N |
| vg0604288046 | T -> G | LOC_Os06g08630.1 | downstream_gene_variant ; 2145.0bp to feature; MODIFIER | silent_mutation | Average:15.735; most accessible tissue: Callus, score: 99.915 | N | N | N | N |
| vg0604288046 | T -> G | LOC_Os06g08610-LOC_Os06g08620 | intergenic_region ; MODIFIER | silent_mutation | Average:15.735; most accessible tissue: Callus, score: 99.915 | N | N | N | N |
| vg0604288046 | T -> DEL | N | N | silent_mutation | Average:15.735; most accessible tissue: Callus, score: 99.915 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604288046 | NA | 8.87E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604288046 | 1.67E-07 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 2.00E-09 | 1.18E-08 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | NA | 3.56E-06 | mr1201 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 2.76E-06 | NA | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 2.08E-08 | 1.32E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | NA | 1.52E-07 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 1.69E-12 | NA | mr1137_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 3.27E-09 | 3.86E-10 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | 5.08E-07 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604288046 | NA | 6.46E-07 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |