\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604288046:

Variant ID: vg0604288046 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4288046
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.16, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGAGGGAGAAACGCTAGCGCCGACGGCGTGGAACCGGCTCCTTGACTTAGCTCGTTCTAAGTCAGAGGTGTACAGTAATCTGCGTCACGTGCTACAGT[T/G]
CCTCTGACGTAACACTGTAGCAACAGTGCGAAACAGTGAAAAATATGGTTTAGAGTTGCTGTTTGGAAAATACTATTCACGGTACTGTATCGATCTGTTC

Reverse complement sequence

GAACAGATCGATACAGTACCGTGAATAGTATTTTCCAAACAGCAACTCTAAACCATATTTTTCACTGTTTCGCACTGTTGCTACAGTGTTACGTCAGAGG[A/C]
ACTGTAGCACGTGACGCAGATTACTGTACACCTCTGACTTAGAACGAGCTAAGTCAAGGAGCCGGTTCCACGCCGTCGGCGCTAGCGTTTCTCCCTCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.00% 12.40% 0.28% 60.39% NA
All Indica  2759 25.10% 0.80% 0.25% 73.83% NA
All Japonica  1512 23.40% 36.70% 0.07% 39.81% NA
Aus  269 71.40% 0.00% 0.37% 28.25% NA
Indica I  595 22.40% 0.70% 0.00% 76.97% NA
Indica II  465 12.70% 0.40% 0.22% 86.67% NA
Indica III  913 34.40% 0.30% 0.44% 64.84% NA
Indica Intermediate  786 23.80% 1.70% 0.25% 74.30% NA
Temperate Japonica  767 33.10% 62.80% 0.13% 3.91% NA
Tropical Japonica  504 7.90% 3.20% 0.00% 88.89% NA
Japonica Intermediate  241 24.90% 23.70% 0.00% 51.45% NA
VI/Aromatic  96 17.70% 0.00% 1.04% 81.25% NA
Intermediate  90 21.10% 7.80% 3.33% 67.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604288046 T -> G LOC_Os06g08620.1 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:15.735; most accessible tissue: Callus, score: 99.915 N N N N
vg0604288046 T -> G LOC_Os06g08610.1 downstream_gene_variant ; 156.0bp to feature; MODIFIER silent_mutation Average:15.735; most accessible tissue: Callus, score: 99.915 N N N N
vg0604288046 T -> G LOC_Os06g08630.1 downstream_gene_variant ; 2145.0bp to feature; MODIFIER silent_mutation Average:15.735; most accessible tissue: Callus, score: 99.915 N N N N
vg0604288046 T -> G LOC_Os06g08610-LOC_Os06g08620 intergenic_region ; MODIFIER silent_mutation Average:15.735; most accessible tissue: Callus, score: 99.915 N N N N
vg0604288046 T -> DEL N N silent_mutation Average:15.735; most accessible tissue: Callus, score: 99.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604288046 NA 8.87E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604288046 1.67E-07 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 2.00E-09 1.18E-08 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 NA 3.56E-06 mr1201 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 2.76E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 2.08E-08 1.32E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 NA 1.52E-07 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 1.69E-12 NA mr1137_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 3.27E-09 3.86E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 5.08E-07 NA mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604288046 NA 6.46E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251