\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604287833:

Variant ID: vg0604287833 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4287833
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATTGCTGTTTTACCCCCACTTTTTAGGGTTTGCAGTTTTACCCCTATTTTTTGAATCTGAACCAGCCGTCTACCCTCACTTGTGACAGCCGTTTGGT[A/G]
GGTCCCACGTTTTATGTTAAAGAAATACAAAAGAAAATAAAGAAAAGGTTTTAGGGTATGGATAAATATGCAATTACCTTTGTACCCCTAGGGAGTGGAT

Reverse complement sequence

ATCCACTCCCTAGGGGTACAAAGGTAATTGCATATTTATCCATACCCTAAAACCTTTTCTTTATTTTCTTTTGTATTTCTTTAACATAAAACGTGGGACC[T/C]
ACCAAACGGCTGTCACAAGTGAGGGTAGACGGCTGGTTCAGATTCAAAAAATAGGGGTAAAACTGCAAACCCTAAAAAGTGGGGGTAAAACAGCAATTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 0.20% 1.10% 60.14% NA
All Indica  2759 24.70% 0.20% 1.67% 73.40% NA
All Japonica  1512 60.10% 0.10% 0.07% 39.75% NA
Aus  269 71.40% 0.00% 0.37% 28.25% NA
Indica I  595 24.00% 0.00% 0.17% 75.80% NA
Indica II  465 13.50% 0.40% 0.65% 85.38% NA
Indica III  913 30.80% 0.00% 3.72% 65.50% NA
Indica Intermediate  786 24.80% 0.50% 1.02% 73.66% NA
Temperate Japonica  767 96.10% 0.00% 0.00% 3.91% NA
Tropical Japonica  504 10.50% 0.40% 0.20% 88.89% NA
Japonica Intermediate  241 49.00% 0.00% 0.00% 51.04% NA
VI/Aromatic  96 18.80% 0.00% 1.04% 80.21% NA
Intermediate  90 23.30% 3.30% 3.33% 70.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604287833 A -> G LOC_Os06g08610.1 3_prime_UTR_variant ; 72.0bp to feature; MODIFIER silent_mutation Average:15.209; most accessible tissue: Callus, score: 97.825 N N N N
vg0604287833 A -> G LOC_Os06g08620.1 upstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:15.209; most accessible tissue: Callus, score: 97.825 N N N N
vg0604287833 A -> G LOC_Os06g08630.1 downstream_gene_variant ; 2358.0bp to feature; MODIFIER silent_mutation Average:15.209; most accessible tissue: Callus, score: 97.825 N N N N
vg0604287833 A -> DEL N N silent_mutation Average:15.209; most accessible tissue: Callus, score: 97.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604287833 2.89E-07 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.50E-06 6.03E-21 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.17E-10 NA mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 1.91E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 5.06E-13 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.62E-09 1.33E-29 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.95E-06 4.44E-08 mr1611 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 4.04E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 8.69E-12 6.55E-31 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 3.88E-09 5.53E-11 mr1920 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 4.33E-13 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.57E-07 9.77E-22 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 1.64E-10 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 9.83E-08 1.23E-19 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 4.09E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 2.03E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 4.80E-06 NA mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 1.85E-14 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 6.15E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 7.44E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 7.86E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604287833 NA 2.46E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251