\
| Variant ID: vg0604281708 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4281708 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATATATGAAAGAGGGTATTGCTTGAATCGTCCAATGGGTAGTCCTTAATAAATAGTTCCCTGCGTGTGTATTTGAGGCTGGTCTAGTAACTAGCCACAT[T/C]
TCAGTTTTGATATCTTTCTATCGATGACTCTATAAACTGTAAGTCTGTAACCCTCCTATTGAAAAAAAAGGTCTATTTGATTCAAAACTCCCATTCAATC
GATTGAATGGGAGTTTTGAATCAAATAGACCTTTTTTTTCAATAGGAGGGTTACAGACTTACAGTTTATAGAGTCATCGATAGAAAGATATCAAAACTGA[A/G]
ATGTGGCTAGTTACTAGACCAGCCTCAAATACACACGCAGGGAACTATTTATTAAGGACTACCCATTGGACGATTCAAGCAATACCCTCTTTCATATATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604281708 | T -> C | LOC_Os06g08610.1 | upstream_gene_variant ; 5000.0bp to feature; MODIFIER | silent_mutation | Average:68.62; most accessible tissue: Callus, score: 85.664 | N | N | N | N |
| vg0604281708 | T -> C | LOC_Os06g08600.1 | downstream_gene_variant ; 4568.0bp to feature; MODIFIER | silent_mutation | Average:68.62; most accessible tissue: Callus, score: 85.664 | N | N | N | N |
| vg0604281708 | T -> C | LOC_Os06g08600-LOC_Os06g08610 | intergenic_region ; MODIFIER | silent_mutation | Average:68.62; most accessible tissue: Callus, score: 85.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604281708 | 1.86E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0604281708 | 6.44E-12 | 1.02E-30 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 5.75E-08 | 5.01E-17 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 4.31E-21 | 5.55E-56 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 4.04E-11 | 1.86E-23 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 9.38E-08 | 2.07E-25 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 8.36E-06 | 5.60E-13 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 6.75E-21 | 1.13E-48 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 5.23E-12 | 7.29E-21 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 5.68E-11 | 1.99E-28 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 2.72E-07 | 1.25E-13 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 1.34E-12 | 2.93E-33 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 9.72E-09 | 2.02E-17 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 1.87E-30 | 1.37E-69 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 2.76E-15 | 4.34E-28 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 1.39E-07 | NA | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 5.93E-10 | 2.14E-28 | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 2.98E-08 | 1.14E-15 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 7.40E-19 | 2.22E-44 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604281708 | 2.80E-11 | 6.42E-18 | mr1617_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |