\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604220066:

Variant ID: vg0604220066 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4220066
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTTAAAAAAAACATTTATTACACATTTCCTATTACAATGAATCTTGTATTAGAAAATATCTCATCCAATATTTAGATTGTTTTTTTTAAGGGAGTATT[C/T]
GTCTTCATTCTGGTGCTTCTCATCCAACGTAGAAGCTTGTGTGCTCTTCGTGTGTAGGTAATGGCTAAAGGATCCAATCCACCCATATAGTCAATCTCAT

Reverse complement sequence

ATGAGATTGACTATATGGGTGGATTGGATCCTTTAGCCATTACCTACACACGAAGAGCACACAAGCTTCTACGTTGGATGAGAAGCACCAGAATGAAGAC[G/A]
AATACTCCCTTAAAAAAAACAATCTAAATATTGGATGAGATATTTTCTAATACAAGATTCATTGTAATAGGAAATGTGTAATAAATGTTTTTTTTAACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.00% 4.90% 0.08% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 91.10% 8.70% 0.13% 0.00% NA
Aus  269 72.50% 27.10% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 85.50% 14.30% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604220066 C -> T LOC_Os06g08530.1 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08540.2 upstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08530.3 upstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08530.2 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08530.4 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08530.5 upstream_gene_variant ; 1463.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08540.1 upstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0604220066 C -> T LOC_Os06g08530-LOC_Os06g08540 intergenic_region ; MODIFIER silent_mutation Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604220066 NA 3.87E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 NA 3.29E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 3.09E-07 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 NA 8.50E-06 mr1008_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 NA 2.03E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 NA 5.55E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066 NA 5.42E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251