\
| Variant ID: vg0604220066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4220066 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGTTAAAAAAAACATTTATTACACATTTCCTATTACAATGAATCTTGTATTAGAAAATATCTCATCCAATATTTAGATTGTTTTTTTTAAGGGAGTATT[C/T]
GTCTTCATTCTGGTGCTTCTCATCCAACGTAGAAGCTTGTGTGCTCTTCGTGTGTAGGTAATGGCTAAAGGATCCAATCCACCCATATAGTCAATCTCAT
ATGAGATTGACTATATGGGTGGATTGGATCCTTTAGCCATTACCTACACACGAAGAGCACACAAGCTTCTACGTTGGATGAGAAGCACCAGAATGAAGAC[G/A]
AATACTCCCTTAAAAAAAACAATCTAAATATTGGATGAGATATTTTCTAATACAAGATTCATTGTAATAGGAAATGTGTAATAAATGTTTTTTTTAACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.90% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.10% | 8.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 72.50% | 27.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.50% | 14.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604220066 | C -> T | LOC_Os06g08530.1 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08540.2 | upstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08530.3 | upstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08530.2 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08530.4 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08530.5 | upstream_gene_variant ; 1463.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08540.1 | upstream_gene_variant ; 4229.0bp to feature; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0604220066 | C -> T | LOC_Os06g08530-LOC_Os06g08540 | intergenic_region ; MODIFIER | silent_mutation | Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604220066 | NA | 3.87E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | NA | 3.29E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | 3.09E-07 | NA | mr1008_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | NA | 8.50E-06 | mr1008_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | NA | 2.03E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | NA | 5.55E-07 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604220066 | NA | 5.42E-08 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |