Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604220066:

Variant ID: vg0604220066 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4220066
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGTTAAAAAAAACATTTATTACACATTTCCTATTACAATGAATCTTGTATTAGAAAATATCTCATCCAATATTTAGATTGTTTTTTTTAAGGGAGTATT[C/T]
GTCTTCATTCTGGTGCTTCTCATCCAACGTAGAAGCTTGTGTGCTCTTCGTGTGTAGGTAATGGCTAAAGGATCCAATCCACCCATATAGTCAATCTCAT

Reverse complement sequence

ATGAGATTGACTATATGGGTGGATTGGATCCTTTAGCCATTACCTACACACGAAGAGCACACAAGCTTCTACGTTGGATGAGAAGCACCAGAATGAAGAC[G/A]
AATACTCCCTTAAAAAAAACAATCTAAATATTGGATGAGATATTTTCTAATACAAGATTCATTGTAATAGGAAATGTGTAATAAATGTTTTTTTTAACGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	4.90%	0.08%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	91.10%	8.70%	0.13%	0.00%	NA
Aus	269	72.50%	27.10%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	85.50%	14.30%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	92.50%	7.10%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604220066	C -> T	LOC_Os06g08530.1	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08540.2	upstream_gene_variant ; 4229.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08530.3	upstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08530.2	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08530.4	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08530.5	upstream_gene_variant ; 1463.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08540.1	upstream_gene_variant ; 4229.0bp to feature; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0604220066	C -> T	LOC_Os06g08530-LOC_Os06g08540	intergenic_region ; MODIFIER	silent_mutation	Average:55.927; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604220066	NA	3.87E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	NA	3.29E-09	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	3.09E-07	NA	mr1008_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	NA	8.50E-06	mr1008_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	NA	2.03E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	NA	5.55E-07	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604220066	NA	5.42E-08	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251