\
| Variant ID: vg0604130041 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4130041 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCCTTCTTTTTCAGCTCAGGCAACCTCCTTATCTTCTCCGGCGCTAGCGGCATCCCTAAACTTTGGTAGGGACCTACAGATTAGGGTCTCGGTTGGGGT[C/T]
AAGGTGGAAGGGGGAAGAGGGGGGGGGGAGTTTGCCTATTTTAGAGGGATGGCCACGTGAGGTGGCAGTCCGGCGGTGAGTAGCGGATTGGGCAGGTGGC
GCCACCTGCCCAATCCGCTACTCACCGCCGGACTGCCACCTCACGTGGCCATCCCTCTAAAATAGGCAAACTCCCCCCCCCCTCTTCCCCCTTCCACCTT[G/A]
ACCCCAACCGAGACCCTAATCTGTAGGTCCCTACCAAAGTTTAGGGATGCCGCTAGCGCCGGAGAAGATAAGGAGGTTGCCTGAGCTGAAAAAGAAGGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 23.20% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 80.90% | 19.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 83.90% | 15.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 1.90% | 97.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 80.20% | 19.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 20.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 64.90% | 34.30% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 21.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604130041 | C -> T | LOC_Os06g08420-LOC_Os06g08440 | intergenic_region ; MODIFIER | silent_mutation | Average:52.933; most accessible tissue: Zhenshan97 panicle, score: 85.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604130041 | NA | 4.06E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 4.01E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 8.35E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 1.26E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 5.95E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 6.02E-06 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 1.18E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | 8.11E-06 | 8.10E-06 | mr1485 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 5.49E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 2.26E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 5.62E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | 8.34E-06 | 6.97E-07 | mr1920 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | 2.53E-06 | 2.53E-06 | mr1853_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604130041 | NA | 1.12E-06 | mr1888_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |