\
| Variant ID: vg0604095633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4095633 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, A: 0.34, others allele: 0.00, population size: 241. )
TCTATTAGAGGAGGAACAAAGAAAGGCAAAGGCAATAGGTTAGTATGGTAACTAATACTAGTACTTCTGCTGTTTGAGTACTTACTGTCCAAAAAGGCTG[A/T]
CATTTGTCCGCTTCTTTACTTCCAGCAGCTGTTCCTTCATATCATTTTTATTCGATGACATCTGTCAAAGTGCTTAGCGTTTTAACTTTTAAGAGAGCCC
GGGCTCTCTTAAAAGTTAAAACGCTAAGCACTTTGACAGATGTCATCGAATAAAAATGATATGAAGGAACAGCTGCTGGAAGTAAAGAAGCGGACAAATG[T/A]
CAGCCTTTTTGGACAGTAAGTACTCAAACAGCAGAAGTACTAGTATTAGTTACCATACTAACCTATTGCCTTTGCCTTTCTTTGTTCCTCCTCTAATAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 40.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604095633 | A -> T | LOC_Os06g08390.1 | downstream_gene_variant ; 3388.0bp to feature; MODIFIER | silent_mutation | Average:33.246; most accessible tissue: Callus, score: 49.495 | N | N | N | N |
| vg0604095633 | A -> T | LOC_Os06g08400.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.246; most accessible tissue: Callus, score: 49.495 | N | N | N | N |
| vg0604095633 | A -> T | LOC_Os06g08400.2 | intron_variant ; MODIFIER | silent_mutation | Average:33.246; most accessible tissue: Callus, score: 49.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604095633 | NA | 4.89E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 1.45E-21 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 1.76E-59 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 2.31E-19 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 4.58E-26 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 2.54E-70 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 3.15E-17 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 3.93E-26 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 4.07E-27 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 6.45E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | 4.83E-07 | NA | mr1750_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 6.99E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 7.42E-06 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 6.62E-08 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 4.78E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 1.55E-09 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604095633 | NA | 1.56E-10 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |