\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604014602:

Variant ID: vg0604014602 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4014602
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTACCTATAAATTAACTCTTATTCTCTAATAAGCCATCTTGGCTTATTAGAAAATATGAACAACCAATAAGGCTCTACGGATTATACTCTGAAGAATTCA[G/A]
GTGGTGTTCTTTTCTTCTGAAGATGAAGATTAAAGTTTTTACGCAAAACGAGGTGGTATTAATGTACAATTGATTGAGTTTTAATTATTACAAACTTGAA

Reverse complement sequence

TTCAAGTTTGTAATAATTAAAACTCAATCAATTGTACATTAATACCACCTCGTTTTGCGTAAAAACTTTAATCTTCATCTTCAGAAGAAAAGAACACCAC[C/T]
TGAATTCTTCAGAGTATAATCCGTAGAGCCTTATTGGTTGTTCATATTTTCTAATAAGCCAAGATGGCTTATTAGAGAATAAGAGTTAATTTATAGGTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 49.40% 0.93% 0.00% NA
All Indica  2759 75.60% 23.40% 1.01% 0.00% NA
All Japonica  1512 11.20% 88.20% 0.60% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 74.10% 23.00% 2.86% 0.00% NA
Indica II  465 67.50% 32.00% 0.43% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 72.60% 26.20% 1.15% 0.00% NA
Temperate Japonica  767 0.80% 99.00% 0.26% 0.00% NA
Tropical Japonica  504 20.80% 79.00% 0.20% 0.00% NA
Japonica Intermediate  241 24.50% 73.00% 2.49% 0.00% NA
VI/Aromatic  96 55.20% 43.80% 1.04% 0.00% NA
Intermediate  90 40.00% 53.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604014602 G -> A LOC_Os06g08290.1 upstream_gene_variant ; 1360.0bp to feature; MODIFIER silent_mutation Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0604014602 G -> A LOC_Os06g08280.1 downstream_gene_variant ; 1063.0bp to feature; MODIFIER silent_mutation Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0604014602 G -> A LOC_Os06g08280-LOC_Os06g08290 intergenic_region ; MODIFIER silent_mutation Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604014602 NA 2.06E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 NA 1.10E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 1.33E-07 1.32E-07 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 NA 1.72E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 2.55E-06 9.49E-08 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 3.71E-06 3.71E-06 mr1427_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 NA 5.69E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 7.96E-06 7.96E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 NA 1.03E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 9.36E-06 9.36E-06 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 NA 7.03E-08 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604014602 8.45E-06 8.45E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251