\
| Variant ID: vg0604014602 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4014602 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 117. )
TTACCTATAAATTAACTCTTATTCTCTAATAAGCCATCTTGGCTTATTAGAAAATATGAACAACCAATAAGGCTCTACGGATTATACTCTGAAGAATTCA[G/A]
GTGGTGTTCTTTTCTTCTGAAGATGAAGATTAAAGTTTTTACGCAAAACGAGGTGGTATTAATGTACAATTGATTGAGTTTTAATTATTACAAACTTGAA
TTCAAGTTTGTAATAATTAAAACTCAATCAATTGTACATTAATACCACCTCGTTTTGCGTAAAAACTTTAATCTTCATCTTCAGAAGAAAAGAACACCAC[C/T]
TGAATTCTTCAGAGTATAATCCGTAGAGCCTTATTGGTTGTTCATATTTTCTAATAAGCCAAGATGGCTTATTAGAGAATAAGAGTTAATTTATAGGTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 49.40% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 75.60% | 23.40% | 1.01% | 0.00% | NA |
| All Japonica | 1512 | 11.20% | 88.20% | 0.60% | 0.00% | NA |
| Aus | 269 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.10% | 23.00% | 2.86% | 0.00% | NA |
| Indica II | 465 | 67.50% | 32.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 83.20% | 16.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 26.20% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 20.80% | 79.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.50% | 73.00% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 43.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 53.30% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604014602 | G -> A | LOC_Os06g08290.1 | upstream_gene_variant ; 1360.0bp to feature; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0604014602 | G -> A | LOC_Os06g08280.1 | downstream_gene_variant ; 1063.0bp to feature; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0604014602 | G -> A | LOC_Os06g08280-LOC_Os06g08290 | intergenic_region ; MODIFIER | silent_mutation | Average:35.078; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604014602 | NA | 2.06E-06 | mr1611 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | NA | 1.10E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 1.33E-07 | 1.32E-07 | mr1312_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | NA | 1.72E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 2.55E-06 | 9.49E-08 | mr1397_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 3.71E-06 | 3.71E-06 | mr1427_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | NA | 5.69E-06 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 7.96E-06 | 7.96E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | NA | 1.03E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 9.36E-06 | 9.36E-06 | mr1687_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | NA | 7.03E-08 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604014602 | 8.45E-06 | 8.45E-06 | mr1847_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |