\
| Variant ID: vg0603908292 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 3908292 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 93. )
AAAGCACTAGAATGCACGCATAAAAATTTTCTTGGTCACTCCATCAACGTTGACAACCCTATCAGGATGAGTATCGATGTGGTAGACCATACTGGAATTC[C/A]
TCTGCTTAATGGCTTGCAGCAAAGTGGGCAAACGGACATACGCTTCACCCCATTAACCGTAAATGAGCTTCATAGCCTCCTCTCGTGCCCTCCAAGCCTT
AAGGCTTGGAGGGCACGAGAGGAGGCTATGAAGCTCATTTACGGTTAATGGGGTGAAGCGTATGTCCGTTTGCCCACTTTGCTGCAAGCCATTAAGCAGA[G/T]
GAATTCCAGTATGGTCTACCACATCGATACTCATCCTGATAGGGTTGTCAACGTTGATGGAGTGACCAAGAAAATTTTTATGCGTGCATTCTAGTGCTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.80% | 40.50% | 12.59% | 2.16% | NA |
| All Indica | 2759 | 17.00% | 68.00% | 12.14% | 2.90% | NA |
| All Japonica | 1512 | 98.50% | 0.60% | 0.73% | 0.13% | NA |
| Aus | 269 | 7.10% | 1.90% | 84.76% | 6.32% | NA |
| Indica I | 595 | 15.00% | 54.50% | 23.19% | 7.39% | NA |
| Indica II | 465 | 48.80% | 45.20% | 6.02% | 0.00% | NA |
| Indica III | 913 | 2.60% | 93.50% | 3.72% | 0.11% | NA |
| Indica Intermediate | 786 | 16.40% | 62.00% | 17.18% | 4.45% | NA |
| Temperate Japonica | 767 | 99.00% | 0.30% | 0.65% | 0.13% | NA |
| Tropical Japonica | 504 | 98.00% | 1.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 7.29% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 24.40% | 15.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603908292 | C -> A | LOC_Os06g08070.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.789; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0603908292 | C -> DEL | N | N | silent_mutation | Average:27.789; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603908292 | NA | 4.98E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 1.47E-11 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 4.20E-07 | mr1611 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 6.87E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 2.31E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 1.61E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 5.57E-08 | mr1920 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 1.37E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 2.86E-12 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 7.06E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 7.19E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603908292 | NA | 3.61E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |