Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603555760:

Variant ID: vg0603555760 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 3555760
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.11, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

CACTTATATTGCGCACTGACCTCCCGTAGAATAAGAACAGCCTCCAGTCGGTTGGGCAGATAATCCCATAAGGATTTGCTATCAATACTATAGAGACGGT[T/C]
GATTTACATTGGTTTTAAAAGTTTACCCGATTTTGTTATTGAGGGATGCAAATCAAAACACGTTCCATCGTTGAGGGGTGCAAAATAGACGTTCTTACTC

Reverse complement sequence

GAGTAAGAACGTCTATTTTGCACCCCTCAACGATGGAACGTGTTTTGATTTGCATCCCTCAATAACAAAATCGGGTAAACTTTTAAAACCAATGTAAATC[A/G]
ACCGTCTCTATAGTATTGATAGCAAATCCTTATGGGATTATCTGCCCAACCGACTGGAGGCTGTTCTTATTCTACGGGAGGTCAGTGCGCAATATAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.50%	0.19%	0.06%	NA
All Indica	2759	67.60%	32.00%	0.22%	0.11%	NA
All Japonica	1512	39.90%	60.10%	0.00%	0.00%	NA
Aus	269	0.00%	99.60%	0.37%	0.00%	NA
Indica I	595	74.50%	25.40%	0.17%	0.00%	NA
Indica II	465	45.20%	54.60%	0.22%	0.00%	NA
Indica III	913	82.70%	17.30%	0.00%	0.00%	NA
Indica Intermediate	786	58.30%	40.80%	0.51%	0.38%	NA
Temperate Japonica	767	21.00%	79.00%	0.00%	0.00%	NA
Tropical Japonica	504	80.60%	19.40%	0.00%	0.00%	NA
Japonica Intermediate	241	14.90%	85.10%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	94.80%	1.04%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0603555760	T -> C	LOC_Os06g07400.1	upstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:61.94; most accessible tissue: Callus, score: 79.041	N	N	N	N
vg0603555760	T -> C	LOC_Os06g07390.1	downstream_gene_variant ; 285.0bp to feature; MODIFIER	silent_mutation	Average:61.94; most accessible tissue: Callus, score: 79.041	N	N	N	N
vg0603555760	T -> C	LOC_Os06g07390-LOC_Os06g07400	intergenic_region ; MODIFIER	silent_mutation	Average:61.94; most accessible tissue: Callus, score: 79.041	N	N	N	N
vg0603555760	T -> DEL	N	N	silent_mutation	Average:61.94; most accessible tissue: Callus, score: 79.041	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0603555760	NA	8.27E-06	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	3.99E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	4.56E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	6.10E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	3.23E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	3.10E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	5.02E-06	mr1154_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	4.57E-07	mr1319_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	2.65E-06	NA	mr1330_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	6.40E-07	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760	NA	3.04E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251