\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603555760:

Variant ID: vg0603555760 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3555760
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.11, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTATATTGCGCACTGACCTCCCGTAGAATAAGAACAGCCTCCAGTCGGTTGGGCAGATAATCCCATAAGGATTTGCTATCAATACTATAGAGACGGT[T/C]
GATTTACATTGGTTTTAAAAGTTTACCCGATTTTGTTATTGAGGGATGCAAATCAAAACACGTTCCATCGTTGAGGGGTGCAAAATAGACGTTCTTACTC

Reverse complement sequence

GAGTAAGAACGTCTATTTTGCACCCCTCAACGATGGAACGTGTTTTGATTTGCATCCCTCAATAACAAAATCGGGTAAACTTTTAAAACCAATGTAAATC[A/G]
ACCGTCTCTATAGTATTGATAGCAAATCCTTATGGGATTATCTGCCCAACCGACTGGAGGCTGTTCTTATTCTACGGGAGGTCAGTGCGCAATATAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.50% 0.19% 0.06% NA
All Indica  2759 67.60% 32.00% 0.22% 0.11% NA
All Japonica  1512 39.90% 60.10% 0.00% 0.00% NA
Aus  269 0.00% 99.60% 0.37% 0.00% NA
Indica I  595 74.50% 25.40% 0.17% 0.00% NA
Indica II  465 45.20% 54.60% 0.22% 0.00% NA
Indica III  913 82.70% 17.30% 0.00% 0.00% NA
Indica Intermediate  786 58.30% 40.80% 0.51% 0.38% NA
Temperate Japonica  767 21.00% 79.00% 0.00% 0.00% NA
Tropical Japonica  504 80.60% 19.40% 0.00% 0.00% NA
Japonica Intermediate  241 14.90% 85.10% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 94.80% 1.04% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603555760 T -> C LOC_Os06g07400.1 upstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:61.94; most accessible tissue: Callus, score: 79.041 N N N N
vg0603555760 T -> C LOC_Os06g07390.1 downstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:61.94; most accessible tissue: Callus, score: 79.041 N N N N
vg0603555760 T -> C LOC_Os06g07390-LOC_Os06g07400 intergenic_region ; MODIFIER silent_mutation Average:61.94; most accessible tissue: Callus, score: 79.041 N N N N
vg0603555760 T -> DEL N N silent_mutation Average:61.94; most accessible tissue: Callus, score: 79.041 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603555760 NA 8.27E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 3.99E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 4.56E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 6.10E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 3.23E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 3.10E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 5.02E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 4.57E-07 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 2.65E-06 NA mr1330_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 6.40E-07 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603555760 NA 3.04E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251