\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603519050:

Variant ID: vg0603519050 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3519050
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACAAACAAGTTCAATAGCAAACTTGAGAACATCATCCAGATTACATAACCATTTGGCAAGTTGAGAGAACAAAATGAAATCAACCAGCTTTGTCCCAT[G/A]
TTTCACATTACAAAAGCATCCAGAACACTAAATATTATATTTAGAAAAGCATTCATTTTTTCCCTTTCTTTGGAGTGATCTTCCTTGCAGCTCTAGTAGG

Reverse complement sequence

CCTACTAGAGCTGCAAGGAAGATCACTCCAAAGAAAGGGAAAAAATGAATGCTTTTCTAAATATAATATTTAGTGTTCTGGATGCTTTTGTAATGTGAAA[C/T]
ATGGGACAAAGCTGGTTGATTTCATTTTGTTCTCTCAACTTGCCAAATGGTTATGTAATCTGGATGATGTTCTCAAGTTTGCTATTGAACTTGTTTGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 14.10% 0.20% 2.79% 82.90% NA
All Indica  2759 5.40% 0.40% 3.26% 90.94% NA
All Japonica  1512 31.10% 0.00% 2.45% 66.47% NA
Aus  269 9.30% 0.00% 1.49% 89.22% NA
Indica I  595 1.70% 0.70% 4.37% 93.28% NA
Indica II  465 4.90% 0.60% 3.01% 91.40% NA
Indica III  913 7.90% 0.10% 3.40% 88.61% NA
Indica Intermediate  786 5.60% 0.40% 2.42% 91.60% NA
Temperate Japonica  767 53.60% 0.00% 0.78% 45.63% NA
Tropical Japonica  504 7.90% 0.00% 5.36% 86.71% NA
Japonica Intermediate  241 7.90% 0.00% 1.66% 90.46% NA
VI/Aromatic  96 6.20% 0.00% 0.00% 93.75% NA
Intermediate  90 16.70% 0.00% 1.11% 82.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603519050 G -> A LOC_Os06g07330.1 upstream_gene_variant ; 1022.0bp to feature; MODIFIER silent_mutation Average:9.102; most accessible tissue: Callus, score: 49.664 N N N N
vg0603519050 G -> A LOC_Os06g07320.1 downstream_gene_variant ; 4330.0bp to feature; MODIFIER silent_mutation Average:9.102; most accessible tissue: Callus, score: 49.664 N N N N
vg0603519050 G -> A LOC_Os06g07330-LOC_Os06g07340 intergenic_region ; MODIFIER silent_mutation Average:9.102; most accessible tissue: Callus, score: 49.664 N N N N
vg0603519050 G -> DEL N N silent_mutation Average:9.102; most accessible tissue: Callus, score: 49.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603519050 1.05E-07 1.51E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 2.03E-07 1.42E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 6.60E-06 5.27E-07 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 5.86E-09 2.41E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 7.60E-08 4.95E-10 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 3.53E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 5.50E-08 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 2.14E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 5.49E-06 2.48E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 3.44E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 1.21E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 2.27E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603519050 NA 5.05E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251