Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0603465711:

Variant ID: vg0603465711 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3465711
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.27, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCGGCCACCACCAGTGCGGCTGCCGGTGTGGATCGTCGTCGTCGCCGCCGTCATGATGACGGCGTCGGTGGTGGTGGAAAGGCGGTAGTAGTAGTAG[T/C]
AGCTTTTCTGCGCGCGCGCAGGTGTGGAGGAGTGGTCGCCGTCACCCCCAGCGAGTTGTCGCTGCCTGCGCGGATTGGAGTGGAGGCGAGCCAACCAACC

Reverse complement sequence

GGTTGGTTGGCTCGCCTCCACTCCAATCCGCGCAGGCAGCGACAACTCGCTGGGGGTGACGGCGACCACTCCTCCACACCTGCGCGCGCGCAGAAAAGCT[A/G]
CTACTACTACTACCGCCTTTCCACCACCACCGACGCCGTCATCATGACGGCGGCGACGACGACGATCCACACCGGCAGCCGCACTGGTGGTGGCCGCGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.80% 0.13% 0.00% NA
All Indica  2759 77.70% 22.10% 0.18% 0.00% NA
All Japonica  1512 70.60% 29.30% 0.07% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 74.80% 24.70% 0.50% 0.00% NA
Indica II  465 86.00% 14.00% 0.00% 0.00% NA
Indica III  913 85.90% 14.00% 0.11% 0.00% NA
Indica Intermediate  786 65.50% 34.40% 0.13% 0.00% NA
Temperate Japonica  767 47.20% 52.80% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.00% 0.41% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603465711 T -> C LOC_Os06g07230.1 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:98.47; most accessible tissue: Minghui63 root, score: 99.784 N N N N
vg0603465711 T -> C LOC_Os06g07240.1 upstream_gene_variant ; 2756.0bp to feature; MODIFIER silent_mutation Average:98.47; most accessible tissue: Minghui63 root, score: 99.784 N N N N
vg0603465711 T -> C LOC_Os06g07230-LOC_Os06g07240 intergenic_region ; MODIFIER silent_mutation Average:98.47; most accessible tissue: Minghui63 root, score: 99.784 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0603465711 T C -0.05 -0.1 -0.09 0.01 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603465711 NA 2.40E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603465711 NA 1.02E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603465711 NA 3.13E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 5.67E-07 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 6.76E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 4.27E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 2.34E-06 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 6.92E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 7.28E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 5.10E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 5.14E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 3.70E-10 mr1629_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 3.22E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603465711 NA 7.09E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251