\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603303648:

Variant ID: vg0603303648 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 3303648
Reference Allele: TAAlternative Allele: AA,T
Primary Allele: TASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTCCAAACACAGGCTGTGTTCTTACCCTCAAGTGCCCAATTCATCTATCTTATTTTCCGCGTACATATTTTTCAAACTATTAAACGGTATGTTTTTT[TA/AA,T]
AAAAAAATCTATATGAAAACGGCTTAAAAAATCATATTAATACATTTATCAAAAAAAATAGCTAATATTTAATTAATCACACACTAATTGATTATTTTGT

Reverse complement sequence

ACAAAATAATCAATTAGTGTGTGATTAATTAAATATTAGCTATTTTTTTTGATAAATGTATTAATATGATTTTTTAAGCCGTTTTCATATAGATTTTTTT[TA/TT,A]
AAAAAACATACCGTTTAATAGTTTGAAAAATATGTACGCGGAAAATAAGATAGATGAATTGGGCACTTGAGGGTAAGAACACAGCCTGTGTTTGGACCCA

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 14.20% 0.99% 0.00% T: 0.04%
All Indica  2759 75.20% 23.10% 1.70% 0.00% T: 0.04%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.00% 0.00% T: 0.37%
Indica I  595 64.50% 34.80% 0.67% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 77.20% 19.70% 2.96% 0.00% T: 0.11%
Indica Intermediate  786 69.00% 29.10% 1.91% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603303648 TA -> AA LOC_Os06g06950.1 upstream_gene_variant ; 503.0bp to feature; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0603303648 TA -> AA LOC_Os06g06960.1 downstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0603303648 TA -> AA LOC_Os06g06950-LOC_Os06g06960 intergenic_region ; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0603303648 TA -> T LOC_Os06g06950.1 upstream_gene_variant ; 504.0bp to feature; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0603303648 TA -> T LOC_Os06g06960.1 downstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0603303648 TA -> T LOC_Os06g06950-LOC_Os06g06960 intergenic_region ; MODIFIER silent_mutation Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603303648 1.62E-06 1.62E-06 mr1369_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603303648 NA 5.79E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603303648 2.31E-06 2.31E-06 mr1453_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603303648 NA 2.69E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251