\
| Variant ID: vg0603303648 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 3303648 |
| Reference Allele: TA | Alternative Allele: AA,T |
| Primary Allele: TA | Secondary Allele: AA |
Inferred Ancestral Allele: Not determined.
TGGGTCCAAACACAGGCTGTGTTCTTACCCTCAAGTGCCCAATTCATCTATCTTATTTTCCGCGTACATATTTTTCAAACTATTAAACGGTATGTTTTTT[TA/AA,T]
AAAAAAATCTATATGAAAACGGCTTAAAAAATCATATTAATACATTTATCAAAAAAAATAGCTAATATTTAATTAATCACACACTAATTGATTATTTTGT
ACAAAATAATCAATTAGTGTGTGATTAATTAAATATTAGCTATTTTTTTTGATAAATGTATTAATATGATTTTTTAAGCCGTTTTCATATAGATTTTTTT[TA/TT,A]
AAAAAACATACCGTTTAATAGTTTGAAAAATATGTACGCGGAAAATAAGATAGATGAATTGGGCACTTGAGGGTAAGAACACAGCCTGTGTTTGGACCCA
| Populations | Population Size | Frequency of TA(primary allele) | Frequency of AA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 14.20% | 0.99% | 0.00% | T: 0.04% |
| All Indica | 2759 | 75.20% | 23.10% | 1.70% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.00% | T: 0.37% |
| Indica I | 595 | 64.50% | 34.80% | 0.67% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 77.20% | 19.70% | 2.96% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 69.00% | 29.10% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603303648 | TA -> AA | LOC_Os06g06950.1 | upstream_gene_variant ; 503.0bp to feature; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0603303648 | TA -> AA | LOC_Os06g06960.1 | downstream_gene_variant ; 1536.0bp to feature; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0603303648 | TA -> AA | LOC_Os06g06950-LOC_Os06g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0603303648 | TA -> T | LOC_Os06g06950.1 | upstream_gene_variant ; 504.0bp to feature; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0603303648 | TA -> T | LOC_Os06g06960.1 | downstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0603303648 | TA -> T | LOC_Os06g06950-LOC_Os06g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:60.373; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603303648 | 1.62E-06 | 1.62E-06 | mr1369_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303648 | NA | 5.79E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303648 | 2.31E-06 | 2.31E-06 | mr1453_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603303648 | NA | 2.69E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |