\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603198141:

Variant ID: vg0603198141 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 3198141
Reference Allele: ATAlternative Allele: TT,ATTTT,ACT,A
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGAATCCATGCTTGCGTTTCATATGCATGCAGTACATTTCTGTCTTTTAATGGTTTACCCAGAACCAAGAACTCATGATAAGGCCTGGTTTAGTTCCAA[AT/TT,ATTTT,ACT,A]
TTTTTTTTTCAGAATTCCAACTTTTTCATCACATTAAAACTTTTCCTACACACATCAATTTTAATCAAACTTTCAATTTTGGCGTGAACTACTACCAGCC

Reverse complement sequence

GGCTGGTAGTAGTTCACGCCAAAATTGAAAGTTTGATTAAAATTGATGTGTGTAGGAAAAGTTTTAATGTGATGAAAAAGTTGGAATTCTGAAAAAAAAA[AT/AA,AAAAT,AGT,T]
TTGGAACTAAACCAGGCCTTATCATGAGTTCTTGGTTCTGGGTAAACCATTAAAAGACAGAAATGTACTGCATGCATATGAAACGCAAGCATGGATTCAG

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 40.30% 2.75% 3.05% ACT: 0.11%; ATTTT: 0.04%; A: 0.02%
All Indica  2759 33.60% 61.60% 2.43% 2.25% ATTTT: 0.07%; ACT: 0.07%
All Japonica  1512 98.50% 0.90% 0.33% 0.07% ACT: 0.20%
Aus  269 19.00% 32.00% 20.45% 28.62% NA
Indica I  595 28.20% 66.20% 3.19% 2.18% ATTTT: 0.17%
Indica II  465 74.60% 25.40% 0.00% 0.00% NA
Indica III  913 11.00% 88.30% 0.22% 0.44% ATTTT: 0.11%
Indica Intermediate  786 39.70% 48.50% 5.85% 5.73% ACT: 0.25%
Temperate Japonica  767 99.00% 0.10% 0.52% 0.00% ACT: 0.39%
Tropical Japonica  504 98.40% 1.20% 0.20% 0.20% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 0.00% 1.04% NA
Intermediate  90 64.40% 27.80% 3.33% 3.33% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603198141 AT -> ACT LOC_Os06g06790.1 upstream_gene_variant ; 1195.0bp to feature; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> ACT LOC_Os06g06780.1 intron_variant ; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> TT LOC_Os06g06790.1 upstream_gene_variant ; 1196.0bp to feature; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> TT LOC_Os06g06780.1 intron_variant ; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> A LOC_Os06g06790.1 upstream_gene_variant ; 1195.0bp to feature; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> A LOC_Os06g06780.1 intron_variant ; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> DEL N N silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> ATTTT LOC_Os06g06790.1 upstream_gene_variant ; 1194.0bp to feature; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg0603198141 AT -> ATTTT LOC_Os06g06780.1 intron_variant ; MODIFIER silent_mutation Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0603198141 AT A 0.02 -0.02 -0.03 0.04 0.03 0.02
vg0603198141 AT ACT 0.05 0.0 0.0 0.03 0.04 0.04
vg0603198141 AT ATTTT 0.08 0.07 0.18 0.04 0.12 0.06
vg0603198141 AT TT 0.0 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603198141 NA 1.94E-21 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603198141 NA 1.51E-20 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603198141 NA 1.66E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.80E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 5.85E-13 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 6.23E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.96E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 6.36E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 6.09E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 3.80E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.46E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 9.37E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.36E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.42E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 5.38E-11 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 4.18E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.71E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.03E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 5.00E-10 mr1268_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 7.06E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.53E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.72E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 3.02E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 4.51E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 9.22E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 4.03E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 9.45E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 5.17E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 8.35E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 2.07E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.36E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 5.43E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.55E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.46E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.32E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 1.09E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 3.80E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 9.56E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 7.49E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 3.61E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 4.67E-10 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141 NA 4.24E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251