Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0603198141:

Variant ID: vg0603198141 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 3198141
Reference Allele: AT	Alternative Allele: TT,ATTTT,ACT,A
Primary Allele: AT	Secondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGAATCCATGCTTGCGTTTCATATGCATGCAGTACATTTCTGTCTTTTAATGGTTTACCCAGAACCAAGAACTCATGATAAGGCCTGGTTTAGTTCCAA[AT/TT,ATTTT,ACT,A]
TTTTTTTTTCAGAATTCCAACTTTTTCATCACATTAAAACTTTTCCTACACACATCAATTTTAATCAAACTTTCAATTTTGGCGTGAACTACTACCAGCC

Reverse complement sequence

GGCTGGTAGTAGTTCACGCCAAAATTGAAAGTTTGATTAAAATTGATGTGTGTAGGAAAAGTTTTAATGTGATGAAAAAGTTGGAATTCTGAAAAAAAAA[AT/AA,AAAAT,AGT,T]
TTGGAACTAAACCAGGCCTTATCATGAGTTCTTGGTTCTGGGTAAACCATTAAAAGACAGAAATGTACTGCATGCATATGAAACGCAAGCATGGATTCAG

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of TT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.70%	40.30%	2.75%	3.05%	ACT: 0.11%; ATTTT: 0.04%; A: 0.02%
All Indica	2759	33.60%	61.60%	2.43%	2.25%	ATTTT: 0.07%; ACT: 0.07%
All Japonica	1512	98.50%	0.90%	0.33%	0.07%	ACT: 0.20%
Aus	269	19.00%	32.00%	20.45%	28.62%	NA
Indica I	595	28.20%	66.20%	3.19%	2.18%	ATTTT: 0.17%
Indica II	465	74.60%	25.40%	0.00%	0.00%	NA
Indica III	913	11.00%	88.30%	0.22%	0.44%	ATTTT: 0.11%
Indica Intermediate	786	39.70%	48.50%	5.85%	5.73%	ACT: 0.25%
Temperate Japonica	767	99.00%	0.10%	0.52%	0.00%	ACT: 0.39%
Tropical Japonica	504	98.40%	1.20%	0.20%	0.20%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	85.40%	0.00%	1.04%	NA
Intermediate	90	64.40%	27.80%	3.33%	3.33%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0603198141	AT -> ACT	LOC_Os06g06790.1	upstream_gene_variant ; 1195.0bp to feature; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> ACT	LOC_Os06g06780.1	intron_variant ; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> TT	LOC_Os06g06790.1	upstream_gene_variant ; 1196.0bp to feature; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> TT	LOC_Os06g06780.1	intron_variant ; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> A	LOC_Os06g06790.1	upstream_gene_variant ; 1195.0bp to feature; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> A	LOC_Os06g06780.1	intron_variant ; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> DEL	N	N	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> ATTTT	LOC_Os06g06790.1	upstream_gene_variant ; 1194.0bp to feature; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N
vg0603198141	AT -> ATTTT	LOC_Os06g06780.1	intron_variant ; MODIFIER	silent_mutation	Average:72.59; most accessible tissue: Zhenshan97 panicle, score: 90.061	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0603198141	AT	A	0.02	-0.02	-0.03	0.04	0.03	0.02
vg0603198141	AT	ACT	0.05	0.0	0.0	0.03	0.04	0.04
vg0603198141	AT	ATTTT	0.08	0.07	0.18	0.04	0.12	0.06
vg0603198141	AT	TT	0.0	0.0	0.0	-0.01	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0603198141	NA	1.94E-21	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603198141	NA	1.51E-20	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0603198141	NA	1.66E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.80E-10	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	5.85E-13	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	6.23E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.96E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	6.36E-06	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	6.09E-06	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	3.80E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.46E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	9.37E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.36E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.42E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	5.38E-11	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	4.18E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.71E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.03E-07	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	5.00E-10	mr1268_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	7.06E-07	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.53E-14	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.72E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	3.02E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	4.51E-10	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	9.22E-07	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	4.03E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	9.45E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	5.17E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	8.35E-06	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	2.07E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.36E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	5.43E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.55E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.46E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.32E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	1.09E-10	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	3.80E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	9.56E-08	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	7.49E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	3.61E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	4.67E-10	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603198141	NA	4.24E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251