Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603070166:

Variant ID: vg0603070166 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 3070166
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAATGCAAATATATATCGCCAGGGGAATGCAAATATTTCTTGCAAATATATAGCGGCAGAGATCGCCGGCAATGCCGCCGATGATTGCGGCGAGCCGG[C/T]
GTAATAGAGCAGTATCTTATCTCAGACGCCGCCGACATTATCGCGTGAAGACATGGAAGTATCGAGCAGTTAGATACTTAGATCGCTGGATCGCATAAAA

Reverse complement sequence

TTTTATGCGATCCAGCGATCTAAGTATCTAACTGCTCGATACTTCCATGTCTTCACGCGATAATGTCGGCGGCGTCTGAGATAAGATACTGCTCTATTAC[G/A]
CCGGCTCGCCGCAATCATCGGCGGCATTGCCGGCGATCTCTGCCGCTATATATTTGCAAGAAATATTTGCATTCCCCTGGCGATATATATTTGCATTCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	9.90%	0.68%	0.00%	NA
All Indica	2759	85.10%	14.80%	0.07%	0.00%	NA
All Japonica	1512	94.30%	3.80%	1.92%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.80%	25.00%	0.17%	0.00%	NA
Indica II	465	77.00%	23.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	80.90%	19.00%	0.13%	0.00%	NA
Temperate Japonica	767	96.20%	0.30%	3.52%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	80.10%	19.10%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0603070166	C -> T	LOC_Os06g06540.1	downstream_gene_variant ; 1429.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0603070166	C -> T	LOC_Os06g06550.1	downstream_gene_variant ; 4020.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0603070166	C -> T	LOC_Os06g06540-LOC_Os06g06550	intergenic_region ; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0603070166	NA	2.49E-06	mr1005	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	NA	6.57E-10	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	NA	2.89E-07	mr1011	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	9.35E-07	9.32E-07	mr1012	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	NA	6.06E-06	mr1012	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	NA	8.60E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603070166	NA	1.80E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251