\
| Variant ID: vg0603070166 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 3070166 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.22, others allele: 0.00, population size: 94. )
GGGAATGCAAATATATATCGCCAGGGGAATGCAAATATTTCTTGCAAATATATAGCGGCAGAGATCGCCGGCAATGCCGCCGATGATTGCGGCGAGCCGG[C/T]
GTAATAGAGCAGTATCTTATCTCAGACGCCGCCGACATTATCGCGTGAAGACATGGAAGTATCGAGCAGTTAGATACTTAGATCGCTGGATCGCATAAAA
TTTTATGCGATCCAGCGATCTAAGTATCTAACTGCTCGATACTTCCATGTCTTCACGCGATAATGTCGGCGGCGTCTGAGATAAGATACTGCTCTATTAC[G/A]
CCGGCTCGCCGCAATCATCGGCGGCATTGCCGGCGATCTCTGCCGCTATATATTTGCAAGAAATATTTGCATTCCCCTGGCGATATATATTTGCATTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 9.90% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 85.10% | 14.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 94.30% | 3.80% | 1.92% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 25.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 77.00% | 23.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.90% | 19.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.10% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603070166 | C -> T | LOC_Os06g06540.1 | downstream_gene_variant ; 1429.0bp to feature; MODIFIER | silent_mutation | Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0603070166 | C -> T | LOC_Os06g06550.1 | downstream_gene_variant ; 4020.0bp to feature; MODIFIER | silent_mutation | Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0603070166 | C -> T | LOC_Os06g06540-LOC_Os06g06550 | intergenic_region ; MODIFIER | silent_mutation | Average:34.904; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603070166 | NA | 2.49E-06 | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | NA | 6.57E-10 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | NA | 2.89E-07 | mr1011 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | 9.35E-07 | 9.32E-07 | mr1012 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | NA | 6.06E-06 | mr1012 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | NA | 8.60E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603070166 | NA | 1.80E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |