\
| Variant ID: vg0603039595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 3039595 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAAAATTATATATTATGTATGAAATTCATACATATATTGTTAGATGCAAATAGTATGCTCTCTAGTTCATGTAGTTTCAAATATTACATGAATCAGGCC[C/A,T]
TGTTTAGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAA
TTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCTAAACA[G/T,A]
GGCCTGATTCATGTAATATTTGAAACTACATGAACTAGAGAGCATACTATTTGCATCTAACAATATATGTATGAATTTCATACATAATATATAATTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 9.60% | 3.28% | 45.20% | T: 0.70% |
| All Indica | 2759 | 26.80% | 2.60% | 3.23% | 66.36% | T: 1.01% |
| All Japonica | 1512 | 73.80% | 23.70% | 1.85% | 0.66% | NA |
| Aus | 269 | 1.10% | 0.70% | 10.78% | 86.25% | T: 1.12% |
| Indica I | 595 | 28.40% | 0.30% | 3.53% | 67.39% | T: 0.34% |
| Indica II | 465 | 68.20% | 4.50% | 1.72% | 25.16% | T: 0.43% |
| Indica III | 913 | 2.20% | 1.90% | 3.40% | 90.47% | T: 2.08% |
| Indica Intermediate | 786 | 29.60% | 4.10% | 3.69% | 61.96% | T: 0.64% |
| Temperate Japonica | 767 | 98.60% | 0.40% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 31.00% | 64.10% | 3.77% | 1.19% | NA |
| Japonica Intermediate | 241 | 84.60% | 13.30% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 45.80% | 3.10% | 3.12% | 47.92% | NA |
| Intermediate | 90 | 53.30% | 18.90% | 6.67% | 18.89% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603039595 | C -> T | LOC_Os06g06470.1 | upstream_gene_variant ; 2595.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> T | LOC_Os06g06450.1 | downstream_gene_variant ; 205.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> T | LOC_Os06g06460.1 | downstream_gene_variant ; 497.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> T | LOC_Os06g06450-LOC_Os06g06460 | intergenic_region ; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> A | LOC_Os06g06470.1 | upstream_gene_variant ; 2595.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> A | LOC_Os06g06450.1 | downstream_gene_variant ; 205.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> A | LOC_Os06g06460.1 | downstream_gene_variant ; 497.0bp to feature; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> A | LOC_Os06g06450-LOC_Os06g06460 | intergenic_region ; MODIFIER | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0603039595 | C -> DEL | N | N | silent_mutation | Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603039595 | NA | 6.38E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 2.08E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 1.90E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | 3.74E-06 | NA | mr1115_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 1.96E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 8.42E-06 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 5.81E-08 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 9.23E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 1.40E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 2.35E-11 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603039595 | NA | 1.76E-11 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |