\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603039595:

Variant ID: vg0603039595 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3039595
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAAATTATATATTATGTATGAAATTCATACATATATTGTTAGATGCAAATAGTATGCTCTCTAGTTCATGTAGTTTCAAATATTACATGAATCAGGCC[C/A,T]
TGTTTAGATGGGACTAAAACTTTTAAGTCCCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAA

Reverse complement sequence

TTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGGGACTTAAAAGTTTTAGTCCCATCTAAACA[G/T,A]
GGCCTGATTCATGTAATATTTGAAACTACATGAACTAGAGAGCATACTATTTGCATCTAACAATATATGTATGAATTTCATACATAATATATAATTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 9.60% 3.28% 45.20% T: 0.70%
All Indica  2759 26.80% 2.60% 3.23% 66.36% T: 1.01%
All Japonica  1512 73.80% 23.70% 1.85% 0.66% NA
Aus  269 1.10% 0.70% 10.78% 86.25% T: 1.12%
Indica I  595 28.40% 0.30% 3.53% 67.39% T: 0.34%
Indica II  465 68.20% 4.50% 1.72% 25.16% T: 0.43%
Indica III  913 2.20% 1.90% 3.40% 90.47% T: 2.08%
Indica Intermediate  786 29.60% 4.10% 3.69% 61.96% T: 0.64%
Temperate Japonica  767 98.60% 0.40% 0.91% 0.13% NA
Tropical Japonica  504 31.00% 64.10% 3.77% 1.19% NA
Japonica Intermediate  241 84.60% 13.30% 0.83% 1.24% NA
VI/Aromatic  96 45.80% 3.10% 3.12% 47.92% NA
Intermediate  90 53.30% 18.90% 6.67% 18.89% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603039595 C -> T LOC_Os06g06470.1 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> T LOC_Os06g06450.1 downstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> T LOC_Os06g06460.1 downstream_gene_variant ; 497.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> T LOC_Os06g06450-LOC_Os06g06460 intergenic_region ; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> A LOC_Os06g06470.1 upstream_gene_variant ; 2595.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> A LOC_Os06g06450.1 downstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> A LOC_Os06g06460.1 downstream_gene_variant ; 497.0bp to feature; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> A LOC_Os06g06450-LOC_Os06g06460 intergenic_region ; MODIFIER silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0603039595 C -> DEL N N silent_mutation Average:35.148; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603039595 NA 6.38E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 2.08E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 1.90E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 3.74E-06 NA mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 1.96E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 8.42E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 5.81E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 9.23E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 1.40E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 2.35E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603039595 NA 1.76E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251