Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602961865:

Variant ID: vg0602961865 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2961865
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGAAAGATCAATTTTGAAGACTGTAAATACCCAAAACAGCTTGTTTCTTGACGGGAGGGAGTTAAACCTACAAAATTCATTCCCCACAAAAAAAAA[C/A]
CCTACAAAATTCACCATTATTTGAAGCCCCCATAGTTCCAAACACAAAAATCGAATCATTTTACAGCCTCATGGCTGACTCTACGGTTGATAAGCTTAAA

Reverse complement sequence

TTTAAGCTTATCAACCGTAGAGTCAGCCATGAGGCTGTAAAATGATTCGATTTTTGTGTTTGGAACTATGGGGGCTTCAAATAATGGTGAATTTTGTAGG[G/T]
TTTTTTTTTGTGGGGAATGAATTTTGTAGGTTTAACTCCCTCCCGTCAAGAAACAAGCTGTTTTGGGTATTTACAGTCTTCAAAATTGATCTTTCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	7.90%	1.18%	0.00%	NA
All Indica	2759	85.10%	13.40%	1.45%	0.00%	NA
All Japonica	1512	98.90%	0.10%	0.99%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.80%	21.20%	4.03%	0.00%	NA
Indica II	465	77.00%	22.40%	0.65%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	80.80%	17.60%	1.65%	0.00%	NA
Temperate Japonica	767	98.20%	0.00%	1.83%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602961865	C -> A	LOC_Os06g06370.1	upstream_gene_variant ; 4904.0bp to feature; MODIFIER	silent_mutation	Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0602961865	C -> A	LOC_Os06g06350.1	downstream_gene_variant ; 4023.0bp to feature; MODIFIER	silent_mutation	Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0602961865	C -> A	LOC_Os06g06350.2	downstream_gene_variant ; 4023.0bp to feature; MODIFIER	silent_mutation	Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0602961865	C -> A	LOC_Os06g06360.1	intron_variant ; MODIFIER	silent_mutation	Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602961865	3.06E-06	8.31E-08	mr1005	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	9.42E-10	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	5.77E-08	mr1011	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	1.85E-06	1.84E-06	mr1012	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	3.76E-06	mr1012	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	5.93E-06	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	4.28E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	3.74E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	8.71E-06	mr1439_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865	NA	6.47E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251