\
| Variant ID: vg0602961865 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2961865 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 76. )
GTGGTGAAAGATCAATTTTGAAGACTGTAAATACCCAAAACAGCTTGTTTCTTGACGGGAGGGAGTTAAACCTACAAAATTCATTCCCCACAAAAAAAAA[C/A]
CCTACAAAATTCACCATTATTTGAAGCCCCCATAGTTCCAAACACAAAAATCGAATCATTTTACAGCCTCATGGCTGACTCTACGGTTGATAAGCTTAAA
TTTAAGCTTATCAACCGTAGAGTCAGCCATGAGGCTGTAAAATGATTCGATTTTTGTGTTTGGAACTATGGGGGCTTCAAATAATGGTGAATTTTGTAGG[G/T]
TTTTTTTTTGTGGGGAATGAATTTTGTAGGTTTAACTCCCTCCCGTCAAGAAACAAGCTGTTTTGGGTATTTACAGTCTTCAAAATTGATCTTTCACCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 7.90% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 85.10% | 13.40% | 1.45% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 0.10% | 0.99% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 74.80% | 21.20% | 4.03% | 0.00% | NA |
| Indica II | 465 | 77.00% | 22.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 17.60% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 1.83% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602961865 | C -> A | LOC_Os06g06370.1 | upstream_gene_variant ; 4904.0bp to feature; MODIFIER | silent_mutation | Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0602961865 | C -> A | LOC_Os06g06350.1 | downstream_gene_variant ; 4023.0bp to feature; MODIFIER | silent_mutation | Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0602961865 | C -> A | LOC_Os06g06350.2 | downstream_gene_variant ; 4023.0bp to feature; MODIFIER | silent_mutation | Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0602961865 | C -> A | LOC_Os06g06360.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602961865 | 3.06E-06 | 8.31E-08 | mr1005 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 9.42E-10 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 5.77E-08 | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | 1.85E-06 | 1.84E-06 | mr1012 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 3.76E-06 | mr1012 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 5.93E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 4.28E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 3.74E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 8.71E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602961865 | NA | 6.47E-06 | mr1629_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |