\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602961865:

Variant ID: vg0602961865 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2961865
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.03, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGTGAAAGATCAATTTTGAAGACTGTAAATACCCAAAACAGCTTGTTTCTTGACGGGAGGGAGTTAAACCTACAAAATTCATTCCCCACAAAAAAAAA[C/A]
CCTACAAAATTCACCATTATTTGAAGCCCCCATAGTTCCAAACACAAAAATCGAATCATTTTACAGCCTCATGGCTGACTCTACGGTTGATAAGCTTAAA

Reverse complement sequence

TTTAAGCTTATCAACCGTAGAGTCAGCCATGAGGCTGTAAAATGATTCGATTTTTGTGTTTGGAACTATGGGGGCTTCAAATAATGGTGAATTTTGTAGG[G/T]
TTTTTTTTTGTGGGGAATGAATTTTGTAGGTTTAACTCCCTCCCGTCAAGAAACAAGCTGTTTTGGGTATTTACAGTCTTCAAAATTGATCTTTCACCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 7.90% 1.18% 0.00% NA
All Indica  2759 85.10% 13.40% 1.45% 0.00% NA
All Japonica  1512 98.90% 0.10% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.80% 21.20% 4.03% 0.00% NA
Indica II  465 77.00% 22.40% 0.65% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 17.60% 1.65% 0.00% NA
Temperate Japonica  767 98.20% 0.00% 1.83% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602961865 C -> A LOC_Os06g06370.1 upstream_gene_variant ; 4904.0bp to feature; MODIFIER silent_mutation Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0602961865 C -> A LOC_Os06g06350.1 downstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0602961865 C -> A LOC_Os06g06350.2 downstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0602961865 C -> A LOC_Os06g06360.1 intron_variant ; MODIFIER silent_mutation Average:46.444; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602961865 3.06E-06 8.31E-08 mr1005 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 9.42E-10 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 5.77E-08 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 1.85E-06 1.84E-06 mr1012 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 3.76E-06 mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 5.93E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 4.28E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 3.74E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 8.71E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602961865 NA 6.47E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251