\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602901938:

Variant ID: vg0602901938 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2901938
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAAATCAGCTCAAATACGAACGACGTACCAAAATACCGCAAAAACAACTTTAATTTTTATAATAGTAGAGATATATCTGTTTTGTACTACAAGAGT[T/C]
GCTACATTTTTTTTTGAACTTGTTGCTACATTGATTAAACTTGATTGAGAACAAAACGAAAACGTTTTATAATACGCAACAGAAGGATCACGTACAATTC

Reverse complement sequence

GAATTGTACGTGATCCTTCTGTTGCGTATTATAAAACGTTTTCGTTTTGTTCTCAATCAAGTTTAATCAATGTAGCAACAAGTTCAAAAAAAAATGTAGC[A/G]
ACTCTTGTAGTACAAAACAGATATATCTCTACTATTATAAAAATTAAAGTTGTTTTTGCGGTATTTTGGTACGTCGTTCGTATTTGAGCTGATTTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.80% 0.02% 0.00% NA
All Indica  2759 90.00% 10.00% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 88.70% 11.10% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 79.10% 20.90% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602901938 T -> C LOC_Os06g06280.1 upstream_gene_variant ; 330.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 99.329 N N N N
vg0602901938 T -> C LOC_Os06g06280.2 upstream_gene_variant ; 345.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 99.329 N N N N
vg0602901938 T -> C LOC_Os06g06260.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 99.329 N N N N
vg0602901938 T -> C LOC_Os06g06270.1 downstream_gene_variant ; 797.0bp to feature; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 99.329 N N N N
vg0602901938 T -> C LOC_Os06g06270-LOC_Os06g06280 intergenic_region ; MODIFIER silent_mutation Average:76.628; most accessible tissue: Callus, score: 99.329 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602901938 NA 1.86E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 1.59E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 3.51E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 5.36E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 9.16E-08 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 1.19E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 2.86E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 3.15E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 5.73E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 2.96E-06 5.27E-09 mr1125_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 7.38E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 3.99E-06 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 2.26E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 1.26E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602901938 NA 1.12E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251