Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0602898411:

Variant ID: vg0602898411 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 2898411
Reference Allele: CAlternative Allele: T,CGGTATACCGTTCAAT
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCAAACATGCGTGATGATAATCCTAGCAGCACGCGACATACTCGGGAGAAGCCGGCACGCGGGGCCGCGTCATGGGGGATAAGCGGTATACCATTCAA[C/T,CGGTATACCGTTCAAT]
GGTATACCGTTGTGTAGTCTTTCTCTTTTAGTAATTAGGGAGTCGAGATATCCCGGTATTGTGGTTTAGGGATACGAATTAGATTAAGCCTCTAGTTAAG

Reverse complement sequence

CTTAACTAGAGGCTTAATCTAATTCGTATCCCTAAACCACAATACCGGGATATCTCGACTCCCTAATTACTAAAAGAGAAAGACTACACAACGGTATACC[G/A,ATTGAACGGTATACCG]
TTGAATGGTATACCGCTTATCCCCCATGACGCGGCCCCGCGTGCCGGCTTCTCCCGAGTATGTCGCGTGCTGCTAGGATTATCATCACGCATGTTTGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 8.80% 0.04% 0.00% CGGTATACCGTTCAAT: 0.06%
All Indica  2759 92.00% 7.80% 0.07% 0.00% CGGTATACCGTTCAAT: 0.07%
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 29.40% 70.30% 0.00% 0.00% CGGTATACCGTTCAAT: 0.37%
Indica I  595 88.70% 10.90% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 82.40% 17.30% 0.00% 0.00% CGGTATACCGTTCAAT: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602898411 C -> T LOC_Os06g06260.1 upstream_gene_variant ; 373.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06270.1 upstream_gene_variant ; 2404.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06280.1 upstream_gene_variant ; 3857.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06280.2 upstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06250.2 downstream_gene_variant ; 2542.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06250.1 downstream_gene_variant ; 2542.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> T LOC_Os06g06250-LOC_Os06g06260 intergenic_region ; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06260.1 upstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06270.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06280.1 upstream_gene_variant ; 3856.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06280.2 upstream_gene_variant ; 3871.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06250.2 downstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06250.1 downstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N
vg0602898411 C -> CGGTATACCGTTCAAT LOC_Os06g06250-LOC_Os06g06260 intergenic_region ; MODIFIER silent_mutation Average:94.557; most accessible tissue: Minghui63 panicle, score: 98.103 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0602898411 C CGGTA* -0.03 0.02 0.08 -0.05 0.0 0.04
vg0602898411 C T -0.04 -0.04 -0.04 -0.04 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602898411 NA 1.22E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411 NA 3.44E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411 NA 2.57E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411 NA 2.85E-08 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602898411 NA 2.08E-09 mr1125_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251