Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0602873031:

Variant ID: vg0602873031 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2873031
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATACTTTATTACCTGAGCAGACATAGAGAAGTACTGCCCGAGTAAATTATTTGACCACACGTGTTGTGCCATTTTTACGATGTTTGCATTGGCACC[C/T]
AGTTAATGTAGGCGGCCTTCACGACAATCTGCCCATATTAACTATTTACATGGGATAAAGAAAATGTTCACTTTTATGTTCCATGTCGTCGAATTTCAAA

Reverse complement sequence

TTTGAAATTCGACGACATGGAACATAAAAGTGAACATTTTCTTTATCCCATGTAAATAGTTAATATGGGCAGATTGTCGTGAAGGCCGCCTACATTAACT[G/A]
GGTGCCAATGCAAACATCGTAAAAATGGCACAACACGTGTGGTCAAATAATTTACTCGGGCAGTACTTCTCTATGTCTGCTCAGGTAATAAAGTATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	5.30%	0.02%	0.00%	NA
All Indica	2759	97.30%	2.70%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	36.80%	62.80%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	96.30%	3.70%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	5.00%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602873031	C -> T	LOC_Os06g06200.1	upstream_gene_variant ; 331.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 65.248	N	N	N	N
vg0602873031	C -> T	LOC_Os06g06210.2	upstream_gene_variant ; 1319.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 65.248	N	N	N	N
vg0602873031	C -> T	LOC_Os06g06220.1	upstream_gene_variant ; 4409.0bp to feature; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 65.248	N	N	N	N
vg0602873031	C -> T	LOC_Os06g06200-LOC_Os06g06210	intergenic_region ; MODIFIER	silent_mutation	Average:40.964; most accessible tissue: Callus, score: 65.248	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602873031	NA	3.13E-08	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	7.71E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	2.10E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	5.08E-08	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	2.61E-07	mr1445	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	2.23E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	2.50E-09	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	9.79E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	7.83E-09	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	4.21E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031	NA	2.09E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251