\
| Variant ID: vg0602873031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2873031 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 259. )
AAAAATACTTTATTACCTGAGCAGACATAGAGAAGTACTGCCCGAGTAAATTATTTGACCACACGTGTTGTGCCATTTTTACGATGTTTGCATTGGCACC[C/T]
AGTTAATGTAGGCGGCCTTCACGACAATCTGCCCATATTAACTATTTACATGGGATAAAGAAAATGTTCACTTTTATGTTCCATGTCGTCGAATTTCAAA
TTTGAAATTCGACGACATGGAACATAAAAGTGAACATTTTCTTTATCCCATGTAAATAGTTAATATGGGCAGATTGTCGTGAAGGCCGCCTACATTAACT[G/A]
GGTGCCAATGCAAACATCGTAAAAATGGCACAACACGTGTGGTCAAATAATTTACTCGGGCAGTACTTCTCTATGTCTGCTCAGGTAATAAAGTATTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 5.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 36.80% | 62.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602873031 | C -> T | LOC_Os06g06200.1 | upstream_gene_variant ; 331.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 65.248 | N | N | N | N |
| vg0602873031 | C -> T | LOC_Os06g06210.2 | upstream_gene_variant ; 1319.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 65.248 | N | N | N | N |
| vg0602873031 | C -> T | LOC_Os06g06220.1 | upstream_gene_variant ; 4409.0bp to feature; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 65.248 | N | N | N | N |
| vg0602873031 | C -> T | LOC_Os06g06200-LOC_Os06g06210 | intergenic_region ; MODIFIER | silent_mutation | Average:40.964; most accessible tissue: Callus, score: 65.248 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602873031 | NA | 3.13E-08 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 7.71E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 2.10E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 5.08E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 2.61E-07 | mr1445 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 2.23E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 2.50E-09 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 9.79E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 7.83E-09 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 4.21E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602873031 | NA | 2.09E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |