\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602873031:

Variant ID: vg0602873031 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2873031
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATACTTTATTACCTGAGCAGACATAGAGAAGTACTGCCCGAGTAAATTATTTGACCACACGTGTTGTGCCATTTTTACGATGTTTGCATTGGCACC[C/T]
AGTTAATGTAGGCGGCCTTCACGACAATCTGCCCATATTAACTATTTACATGGGATAAAGAAAATGTTCACTTTTATGTTCCATGTCGTCGAATTTCAAA

Reverse complement sequence

TTTGAAATTCGACGACATGGAACATAAAAGTGAACATTTTCTTTATCCCATGTAAATAGTTAATATGGGCAGATTGTCGTGAAGGCCGCCTACATTAACT[G/A]
GGTGCCAATGCAAACATCGTAAAAATGGCACAACACGTGTGGTCAAATAATTTACTCGGGCAGTACTTCTCTATGTCTGCTCAGGTAATAAAGTATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.30% 0.02% 0.00% NA
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 36.80% 62.80% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602873031 C -> T LOC_Os06g06200.1 upstream_gene_variant ; 331.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 65.248 N N N N
vg0602873031 C -> T LOC_Os06g06210.2 upstream_gene_variant ; 1319.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 65.248 N N N N
vg0602873031 C -> T LOC_Os06g06220.1 upstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 65.248 N N N N
vg0602873031 C -> T LOC_Os06g06200-LOC_Os06g06210 intergenic_region ; MODIFIER silent_mutation Average:40.964; most accessible tissue: Callus, score: 65.248 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602873031 NA 3.13E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 7.71E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 2.10E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 5.08E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 2.61E-07 mr1445 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 2.23E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 2.50E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 9.79E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 7.83E-09 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 4.21E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602873031 NA 2.09E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251