\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602870012:

Variant ID: vg0602870012 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2870012
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, C: 0.22, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


AATGTCTCCTCTAGGGACAAAAATCCACTTCCGGTATATCACCACCACCCATCACTCTCTACACCTGTCGCTAGCTCGATAGTGCTCACGGTAACGGCCG[G/C]
AAACTGCCCCTCGAATCTCGATCAGCTTAGCTTAGCTATAAATTCAGCACCATGCATGCCATTGCAACCTGCGCCTGAGAACACAGCTAGCTCACTCTCA

Reverse complement sequence

TGAGAGTGAGCTAGCTGTGTTCTCAGGCGCAGGTTGCAATGGCATGCATGGTGCTGAATTTATAGCTAAGCTAAGCTGATCGAGATTCGAGGGGCAGTTT[C/G]
CGGCCGTTACCGTGAGCACTATCGAGCTAGCGACAGGTGTAGAGAGTGATGGGTGGTGGTGATATACCGGAAGTGGATTTTTGTCCCTAGAGGAGACATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 5.30% 0.08% 0.00% NA
All Indica  2759 97.20% 2.80% 0.00% 0.00% NA
All Japonica  1512 99.20% 0.60% 0.20% 0.00% NA
Aus  269 41.30% 58.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 99.00% 0.80% 0.26% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602870012 G -> C LOC_Os06g06210.2 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:67.846; most accessible tissue: Callus, score: 89.428 N N N N
vg0602870012 G -> C LOC_Os06g06190.1 downstream_gene_variant ; 2306.0bp to feature; MODIFIER silent_mutation Average:67.846; most accessible tissue: Callus, score: 89.428 N N N N
vg0602870012 G -> C LOC_Os06g06200.1 downstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:67.846; most accessible tissue: Callus, score: 89.428 N N N N
vg0602870012 G -> C LOC_Os06g06190-LOC_Os06g06200 intergenic_region ; MODIFIER silent_mutation Average:67.846; most accessible tissue: Callus, score: 89.428 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602870012 5.32E-06 NA mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602870012 NA 9.17E-11 mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602870012 NA 2.79E-08 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602870012 NA 2.38E-12 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602870012 NA 1.60E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251