\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602854650:

Variant ID: vg0602854650 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2854650
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAATAACGCGCAACCGTTTTCTTACTGGGGCAGACAAGAAGATTTTCGGATTTTTTTATGTAGTATAGAAACAATAATTTTTTTTACTGTCTTTAAGA[G/A]
TTGTCAAAGTTTTTTTTTTGTAAATTTTTTCATCCTAATTTCTAGCATACGAATTTTTAAGTTAGAAAGTATAGTATAACTCATGATACTTATTTAAGTA

Reverse complement sequence

TACTTAAATAAGTATCATGAGTTATACTATACTTTCTAACTTAAAAATTCGTATGCTAGAAATTAGGATGAAAAAATTTACAAAAAAAAAACTTTGACAA[C/T]
TCTTAAAGACAGTAAAAAAAATTATTGTTTCTATACTACATAAAAAAATCCGAAAATCTTCTTGTCTGCCCCAGTAAGAAAACGGTTGCGCGTTATTGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.80% 0.23% 0.00% NA
All Indica  2759 81.30% 18.40% 0.29% 0.00% NA
All Japonica  1512 0.50% 99.40% 0.07% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 77.80% 21.80% 0.34% 0.00% NA
Indica II  465 51.00% 48.80% 0.22% 0.00% NA
Indica III  913 97.90% 1.90% 0.22% 0.00% NA
Indica Intermediate  786 82.70% 16.90% 0.38% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 30.00% 67.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602854650 G -> A LOC_Os06g06160.1 upstream_gene_variant ; 791.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0602854650 G -> A LOC_Os06g06160.4 upstream_gene_variant ; 804.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0602854650 G -> A LOC_Os06g06160.3 upstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0602854650 G -> A LOC_Os06g06160.5 upstream_gene_variant ; 997.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0602854650 G -> A LOC_Os06g06160.2 upstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0602854650 G -> A LOC_Os06g06150-LOC_Os06g06160 intergenic_region ; MODIFIER silent_mutation Average:44.374; most accessible tissue: Minghui63 root, score: 59.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602854650 NA 6.97E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 9.59E-11 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.83E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 3.25E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 2.82E-09 9.84E-67 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 4.95E-07 7.11E-28 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 5.57E-19 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.82E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.67E-28 mr1150 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 3.03E-07 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 2.38E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 5.25E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 3.17E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.10E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 7.50E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 3.49E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.44E-13 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 4.26E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 5.06E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.29E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 5.64E-06 4.19E-72 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.54E-25 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 3.39E-29 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 7.47E-34 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 2.00E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.65E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 1.40E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 2.36E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602854650 NA 4.89E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251