\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602813024:

Variant ID: vg0602813024 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2813024
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCGCGAGATTTGGTCGCTTTCGGCCTCGTTTTGTAGCTCTCGCCTCTTTTTTTTTTGTGTGTGTTTTTTTTGTGTGTGGGTGTGTGTGTGCTCGCG[T/C]
GTGTTTTCTCTTGGGCTGTGGAGGTGGGGGTGGTGGCCCACCGGGGTATAAAATGGTTGGCACGCGGGGCTACGGGTACTAGGCGTGGCCCATTTTTGGG

Reverse complement sequence

CCCAAAAATGGGCCACGCCTAGTACCCGTAGCCCCGCGTGCCAACCATTTTATACCCCGGTGGGCCACCACCCCCACCTCCACAGCCCAAGAGAAAACAC[A/G]
CGCGAGCACACACACACCCACACACAAAAAAAACACACACAAAAAAAAAAGAGGCGAGAGCTACAAAACGAGGCCGAAAGCGACCAAATCTCGCGACGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 3.00% 5.01% 1.21% NA
All Indica  2759 89.70% 1.50% 6.71% 2.03% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 46.10% 35.70% 18.22% 0.00% NA
Indica I  595 90.10% 0.00% 8.91% 1.01% NA
Indica II  465 96.60% 0.00% 2.80% 0.65% NA
Indica III  913 86.90% 2.20% 6.68% 4.27% NA
Indica Intermediate  786 88.80% 2.80% 7.38% 1.02% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602813024 T -> C LOC_Os06g06090.1 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:99.693; most accessible tissue: Minghui63 root, score: 99.898 N N N N
vg0602813024 T -> C LOC_Os06g06090.2 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:99.693; most accessible tissue: Minghui63 root, score: 99.898 N N N N
vg0602813024 T -> C LOC_Os06g06100.1 downstream_gene_variant ; 2923.0bp to feature; MODIFIER silent_mutation Average:99.693; most accessible tissue: Minghui63 root, score: 99.898 N N N N
vg0602813024 T -> C LOC_Os06g06090-LOC_Os06g06100 intergenic_region ; MODIFIER silent_mutation Average:99.693; most accessible tissue: Minghui63 root, score: 99.898 N N N N
vg0602813024 T -> DEL N N silent_mutation Average:99.693; most accessible tissue: Minghui63 root, score: 99.898 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0602813024 T C 0.02 0.03 0.03 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602813024 NA 6.81E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 7.75E-07 NA mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 1.39E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 2.06E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 4.90E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 2.80E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 1.27E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 4.26E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 1.06E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 6.61E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 1.08E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 NA 1.61E-07 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602813024 3.21E-06 NA mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251