\
| Variant ID: vg0602731257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2731257 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TACGCACCATTCTTTTATAATTTCATAAATTTTATACGAATACTTCAACCAAATTATCACAAAACTATAAATATGTATCACAAAACTACAGATTTAGCAT[C/T]
AAATTTATCGTAAAACTACATATGTCAGATCTAAGGTACCATATCACAAAACTACAAATTTTACAAATTTAGTGATGATGGTATCAAAGAACTATAATTT
AAATTATAGTTCTTTGATACCATCATCACTAAATTTGTAAAATTTGTAGTTTTGTGATATGGTACCTTAGATCTGACATATGTAGTTTTACGATAAATTT[G/A]
ATGCTAAATCTGTAGTTTTGTGATACATATTTATAGTTTTGTGATAATTTGGTTGAAGTATTCGTATAAAATTTATGAAATTATAAAAGAATGGTGCGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 4.10% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 85.30% | 12.00% | 2.71% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 0.50% | 2.87% | 0.00% | NA |
| Tropical Japonica | 504 | 67.90% | 30.00% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 11.20% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 4.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602731257 | C -> T | LOC_Os06g05950.1 | upstream_gene_variant ; 4719.0bp to feature; MODIFIER | silent_mutation | Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 | N | N | N | N |
| vg0602731257 | C -> T | LOC_Os06g05960.1 | upstream_gene_variant ; 1543.0bp to feature; MODIFIER | silent_mutation | Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 | N | N | N | N |
| vg0602731257 | C -> T | LOC_Os06g05950.2 | upstream_gene_variant ; 4722.0bp to feature; MODIFIER | silent_mutation | Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 | N | N | N | N |
| vg0602731257 | C -> T | LOC_Os06g05950.3 | upstream_gene_variant ; 4722.0bp to feature; MODIFIER | silent_mutation | Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 | N | N | N | N |
| vg0602731257 | C -> T | LOC_Os06g05950-LOC_Os06g05960 | intergenic_region ; MODIFIER | silent_mutation | Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602731257 | NA | 1.67E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | 5.45E-06 | 5.45E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | NA | 6.35E-06 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | NA | 9.72E-07 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | NA | 4.31E-06 | mr1812_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | 2.76E-06 | 2.76E-06 | mr1832_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602731257 | 6.37E-06 | 6.37E-06 | mr1843_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |