Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602731257:

Variant ID: vg0602731257 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2731257
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGCACCATTCTTTTATAATTTCATAAATTTTATACGAATACTTCAACCAAATTATCACAAAACTATAAATATGTATCACAAAACTACAGATTTAGCAT[C/T]
AAATTTATCGTAAAACTACATATGTCAGATCTAAGGTACCATATCACAAAACTACAAATTTTACAAATTTAGTGATGATGGTATCAAAGAACTATAATTT

Reverse complement sequence

AAATTATAGTTCTTTGATACCATCATCACTAAATTTGTAAAATTTGTAGTTTTGTGATATGGTACCTTAGATCTGACATATGTAGTTTTACGATAAATTT[G/A]
ATGCTAAATCTGTAGTTTTGTGATACATATTTATAGTTTTGTGATAATTTGGTTGAAGTATTCGTATAAAATTTATGAAATTATAAAAGAATGGTGCGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	4.10%	1.02%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.11%	0.00%	NA
All Japonica	1512	85.30%	12.00%	2.71%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	96.60%	0.50%	2.87%	0.00%	NA
Tropical Japonica	504	67.90%	30.00%	2.18%	0.00%	NA
Japonica Intermediate	241	85.50%	11.20%	3.32%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	92.20%	4.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602731257	C -> T	LOC_Os06g05950.1	upstream_gene_variant ; 4719.0bp to feature; MODIFIER	silent_mutation	Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945	N	N	N	N
vg0602731257	C -> T	LOC_Os06g05960.1	upstream_gene_variant ; 1543.0bp to feature; MODIFIER	silent_mutation	Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945	N	N	N	N
vg0602731257	C -> T	LOC_Os06g05950.2	upstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945	N	N	N	N
vg0602731257	C -> T	LOC_Os06g05950.3	upstream_gene_variant ; 4722.0bp to feature; MODIFIER	silent_mutation	Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945	N	N	N	N
vg0602731257	C -> T	LOC_Os06g05950-LOC_Os06g05960	intergenic_region ; MODIFIER	silent_mutation	Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602731257	NA	1.67E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	5.45E-06	5.45E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	NA	6.35E-06	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	NA	9.72E-07	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	NA	4.31E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	2.76E-06	2.76E-06	mr1832_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257	6.37E-06	6.37E-06	mr1843_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251