\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602731257:

Variant ID: vg0602731257 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2731257
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGCACCATTCTTTTATAATTTCATAAATTTTATACGAATACTTCAACCAAATTATCACAAAACTATAAATATGTATCACAAAACTACAGATTTAGCAT[C/T]
AAATTTATCGTAAAACTACATATGTCAGATCTAAGGTACCATATCACAAAACTACAAATTTTACAAATTTAGTGATGATGGTATCAAAGAACTATAATTT

Reverse complement sequence

AAATTATAGTTCTTTGATACCATCATCACTAAATTTGTAAAATTTGTAGTTTTGTGATATGGTACCTTAGATCTGACATATGTAGTTTTACGATAAATTT[G/A]
ATGCTAAATCTGTAGTTTTGTGATACATATTTATAGTTTTGTGATAATTTGGTTGAAGTATTCGTATAAAATTTATGAAATTATAAAAGAATGGTGCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.10% 1.02% 0.00% NA
All Indica  2759 99.70% 0.20% 0.11% 0.00% NA
All Japonica  1512 85.30% 12.00% 2.71% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 96.60% 0.50% 2.87% 0.00% NA
Tropical Japonica  504 67.90% 30.00% 2.18% 0.00% NA
Japonica Intermediate  241 85.50% 11.20% 3.32% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602731257 C -> T LOC_Os06g05950.1 upstream_gene_variant ; 4719.0bp to feature; MODIFIER silent_mutation Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 N N N N
vg0602731257 C -> T LOC_Os06g05960.1 upstream_gene_variant ; 1543.0bp to feature; MODIFIER silent_mutation Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 N N N N
vg0602731257 C -> T LOC_Os06g05950.2 upstream_gene_variant ; 4722.0bp to feature; MODIFIER silent_mutation Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 N N N N
vg0602731257 C -> T LOC_Os06g05950.3 upstream_gene_variant ; 4722.0bp to feature; MODIFIER silent_mutation Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 N N N N
vg0602731257 C -> T LOC_Os06g05950-LOC_Os06g05960 intergenic_region ; MODIFIER silent_mutation Average:50.476; most accessible tissue: Zhenshan97 flower, score: 77.945 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602731257 NA 1.67E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 5.45E-06 5.45E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 NA 6.35E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 NA 9.72E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 NA 4.31E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 2.76E-06 2.76E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602731257 6.37E-06 6.37E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251