\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602642659:

Variant ID: vg0602642659 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2642659
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCCAGAAGTGTGACGCGGTCCTTCTGAATGACCTGAGCCAGGTTGAGATCAAAAAGCTCACAACGAATTGGCATCTCCATCTCGTAGAATGGATTTTTCA[A/G]
AACAAAATCCGTGTAGAGCTCGTATATGACTTTCAGTAGTGTCTCGATATTTTGAGCACCAGTTTCGCATACAGCAAAAAACTTTGTCCCTGGTGAAACA

Reverse complement sequence

TGTTTCACCAGGGACAAAGTTTTTTGCTGTATGCGAAACTGGTGCTCAAAATATCGAGACACTACTGAAAGTCATATACGAGCTCTACACGGATTTTGTT[T/C]
TGAAAAATCCATTCTACGAGATGGAGATGCCAATTCGTTGTGAGCTTTTTGATCTCAACCTGGCTCAGGTCATTCAGAAGGACCGCGTCACACTTCTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.80% 0.00% 0.02% NA
All Indica  2759 87.50% 12.50% 0.00% 0.04% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 53.10% 46.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.70% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602642659 A -> G LOC_Os06g05804.1 synonymous_variant ; p.Leu109Leu; LOW synonymous_codon Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> G LOC_Os06g05804.2 synonymous_variant ; p.Leu109Leu; LOW synonymous_codon Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> G LOC_Os06g05804.3 synonymous_variant ; p.Leu109Leu; LOW synonymous_codon Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> G LOC_Os06g05804.4 synonymous_variant ; p.Leu65Leu; LOW synonymous_codon Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> DEL LOC_Os06g05804.1 N frameshift_variant Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> DEL LOC_Os06g05804.2 N frameshift_variant Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> DEL LOC_Os06g05804.3 N frameshift_variant Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0602642659 A -> DEL LOC_Os06g05804.4 N frameshift_variant Average:50.145; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602642659 NA 1.45E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 4.36E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 3.41E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 2.07E-16 9.73E-92 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 4.40E-13 6.25E-39 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 2.09E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.17E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 7.65E-24 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 6.99E-17 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.88E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 3.59E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 6.53E-23 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 9.07E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.10E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 2.70E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 5.63E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.15E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 5.76E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.46E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 4.68E-16 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 4.68E-15 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 4.30E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 2.83E-13 7.28E-99 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 7.43E-07 1.57E-33 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 5.19E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 4.48E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.23E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.88E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 2.66E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 1.59E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 3.89E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602642659 NA 6.44E-09 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251