\
| Variant ID: vg0602541654 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 2541654 |
| Reference Allele: T | Alternative Allele: C,A,TATAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCAAAATTTTGACAACTATTGCTAAAATTTTGGTATGATTTCTTATATAATTACCAAATTTGACAGCAAACTAAATGTAGCCATTTTTTTAGCAACTTTA[T/C,A,TATAA]
TAAAATTTGGTAAGGTTGAAAATGCATCAAAGTGAACAGGCCCCAAATTCCCCAATCACCACGGACGCCTCTCCGCCGATCGCGGCCTCGCCGGCGGCGG
CCGCCGCCGGCGAGGCCGCGATCGGCGGAGAGGCGTCCGTGGTGATTGGGGAATTTGGGGCCTGTTCACTTTGATGCATTTTCAACCTTACCAAATTTTA[A/G,T,TTATA]
TAAAGTTGCTAAAAAAATGGCTACATTTAGTTTGCTGTCAAATTTGGTAATTATATAAGAAATCATACCAAAATTTTAGCAATAGTTGTCAAAATTTTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 42.10% | 0.08% | 0.00% | A: 8.78%; TATAA: 0.02% |
| All Indica | 2759 | 80.20% | 12.60% | 0.14% | 0.00% | A: 7.07% |
| All Japonica | 1512 | 0.30% | 99.30% | 0.00% | 0.00% | A: 0.33% |
| Aus | 269 | 1.90% | 20.80% | 0.00% | 0.00% | A: 76.95%; TATAA: 0.37% |
| Indica I | 595 | 96.50% | 1.00% | 0.17% | 0.00% | A: 2.35% |
| Indica II | 465 | 51.40% | 47.50% | 0.00% | 0.00% | A: 1.08% |
| Indica III | 913 | 88.90% | 1.50% | 0.11% | 0.00% | A: 9.42% |
| Indica Intermediate | 786 | 74.70% | 13.60% | 0.25% | 0.00% | A: 11.45% |
| Temperate Japonica | 767 | 0.00% | 99.70% | 0.00% | 0.00% | A: 0.26% |
| Tropical Japonica | 504 | 0.60% | 99.20% | 0.00% | 0.00% | A: 0.20% |
| Japonica Intermediate | 241 | 0.80% | 98.30% | 0.00% | 0.00% | A: 0.83% |
| VI/Aromatic | 96 | 74.00% | 24.00% | 0.00% | 0.00% | A: 2.08% |
| Intermediate | 90 | 26.70% | 66.70% | 0.00% | 0.00% | A: 6.67% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602541654 | T -> C | LOC_Os06g05620.1 | upstream_gene_variant ; 75.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> C | LOC_Os06g05600.1 | downstream_gene_variant ; 4632.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> C | LOC_Os06g05610.1 | downstream_gene_variant ; 2183.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> C | LOC_Os06g05610-LOC_Os06g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> TATAA | LOC_Os06g05620.1 | upstream_gene_variant ; 74.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> TATAA | LOC_Os06g05600.1 | downstream_gene_variant ; 4633.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> TATAA | LOC_Os06g05610.1 | downstream_gene_variant ; 2184.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> TATAA | LOC_Os06g05610-LOC_Os06g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> A | LOC_Os06g05620.1 | upstream_gene_variant ; 75.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> A | LOC_Os06g05600.1 | downstream_gene_variant ; 4632.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> A | LOC_Os06g05610.1 | downstream_gene_variant ; 2183.0bp to feature; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0602541654 | T -> A | LOC_Os06g05610-LOC_Os06g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602541654 | NA | 7.27E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 1.37E-11 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | 2.84E-16 | 5.08E-87 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | 1.89E-12 | 2.79E-37 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 2.65E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 5.18E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 2.52E-18 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 3.29E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | NA | 5.49E-18 | mr1982 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | 4.46E-13 | 8.58E-93 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602541654 | 2.36E-07 | 9.30E-33 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |