\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602541654:

Variant ID: vg0602541654 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 2541654
Reference Allele: TAlternative Allele: C,A,TATAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAAAATTTTGACAACTATTGCTAAAATTTTGGTATGATTTCTTATATAATTACCAAATTTGACAGCAAACTAAATGTAGCCATTTTTTTAGCAACTTTA[T/C,A,TATAA]
TAAAATTTGGTAAGGTTGAAAATGCATCAAAGTGAACAGGCCCCAAATTCCCCAATCACCACGGACGCCTCTCCGCCGATCGCGGCCTCGCCGGCGGCGG

Reverse complement sequence

CCGCCGCCGGCGAGGCCGCGATCGGCGGAGAGGCGTCCGTGGTGATTGGGGAATTTGGGGCCTGTTCACTTTGATGCATTTTCAACCTTACCAAATTTTA[A/G,T,TTATA]
TAAAGTTGCTAAAAAAATGGCTACATTTAGTTTGCTGTCAAATTTGGTAATTATATAAGAAATCATACCAAAATTTTAGCAATAGTTGTCAAAATTTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 42.10% 0.08% 0.00% A: 8.78%; TATAA: 0.02%
All Indica  2759 80.20% 12.60% 0.14% 0.00% A: 7.07%
All Japonica  1512 0.30% 99.30% 0.00% 0.00% A: 0.33%
Aus  269 1.90% 20.80% 0.00% 0.00% A: 76.95%; TATAA: 0.37%
Indica I  595 96.50% 1.00% 0.17% 0.00% A: 2.35%
Indica II  465 51.40% 47.50% 0.00% 0.00% A: 1.08%
Indica III  913 88.90% 1.50% 0.11% 0.00% A: 9.42%
Indica Intermediate  786 74.70% 13.60% 0.25% 0.00% A: 11.45%
Temperate Japonica  767 0.00% 99.70% 0.00% 0.00% A: 0.26%
Tropical Japonica  504 0.60% 99.20% 0.00% 0.00% A: 0.20%
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.00% A: 0.83%
VI/Aromatic  96 74.00% 24.00% 0.00% 0.00% A: 2.08%
Intermediate  90 26.70% 66.70% 0.00% 0.00% A: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602541654 T -> C LOC_Os06g05620.1 upstream_gene_variant ; 75.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> C LOC_Os06g05600.1 downstream_gene_variant ; 4632.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> C LOC_Os06g05610.1 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> C LOC_Os06g05610-LOC_Os06g05620 intergenic_region ; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> TATAA LOC_Os06g05620.1 upstream_gene_variant ; 74.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> TATAA LOC_Os06g05600.1 downstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> TATAA LOC_Os06g05610.1 downstream_gene_variant ; 2184.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> TATAA LOC_Os06g05610-LOC_Os06g05620 intergenic_region ; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> A LOC_Os06g05620.1 upstream_gene_variant ; 75.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> A LOC_Os06g05600.1 downstream_gene_variant ; 4632.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> A LOC_Os06g05610.1 downstream_gene_variant ; 2183.0bp to feature; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0602541654 T -> A LOC_Os06g05610-LOC_Os06g05620 intergenic_region ; MODIFIER silent_mutation Average:62.186; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602541654 NA 7.27E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 1.37E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 2.84E-16 5.08E-87 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 1.89E-12 2.79E-37 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 2.65E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 5.18E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 2.52E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 3.29E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 NA 5.49E-18 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 4.46E-13 8.58E-93 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602541654 2.36E-07 9.30E-33 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251