\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602401598:

Variant ID: vg0602401598 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2401598
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.26, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCTGCATCAGTTTCAGCTCTTTTTCATAGTCAGCGACCTGTTGCATCCAGGCATAATAACAACAGAATCACCGATCATTTTCTTTGTCCCTTTGCATA[A/G]
CACAACACATTGATTGGAAATTTGGAATAATCATCAAAATCACTACTAGTACAGCTAAAATCTGAACAGATGAGCATAAGATTTTTGTACATACAGGGAA

Reverse complement sequence

TTCCCTGTATGTACAAAAATCTTATGCTCATCTGTTCAGATTTTAGCTGTACTAGTAGTGATTTTGATGATTATTCCAAATTTCCAATCAATGTGTTGTG[T/C]
TATGCAAAGGGACAAAGAAAATGATCGGTGATTCTGTTGTTATTATGCCTGGATGCAACAGGTCGCTGACTATGAAAAAGAGCTGAAACTGATGCAGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.60% 0.21% 0.08% NA
All Indica  2759 87.50% 12.10% 0.33% 0.07% NA
All Japonica  1512 1.00% 98.90% 0.07% 0.07% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 53.10% 46.50% 0.43% 0.00% NA
Indica III  913 97.90% 1.90% 0.22% 0.00% NA
Indica Intermediate  786 87.20% 12.20% 0.38% 0.25% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.40% 0.20% 0.20% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602401598 A -> G LOC_Os06g05330.1 upstream_gene_variant ; 2786.0bp to feature; MODIFIER silent_mutation Average:57.906; most accessible tissue: Callus, score: 77.273 N N N N
vg0602401598 A -> G LOC_Os06g05350.1 upstream_gene_variant ; 3811.0bp to feature; MODIFIER silent_mutation Average:57.906; most accessible tissue: Callus, score: 77.273 N N N N
vg0602401598 A -> G LOC_Os06g05340.1 intron_variant ; MODIFIER silent_mutation Average:57.906; most accessible tissue: Callus, score: 77.273 N N N N
vg0602401598 A -> DEL N N silent_mutation Average:57.906; most accessible tissue: Callus, score: 77.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602401598 NA 1.67E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 2.84E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 5.34E-26 1.15E-104 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 2.11E-18 1.92E-41 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 1.21E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 1.03E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 8.86E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 1.00E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 4.60E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 1.06E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 2.21E-23 2.99E-116 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 6.17E-15 3.93E-41 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 5.41E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 8.77E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 2.16E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 2.54E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602401598 NA 5.19E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251