\
| Variant ID: vg0602363435 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2363435 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )
AACTAATGGCTCCAATTAGTATGTGTTTTTTTTTCCCTAGCATGTCACACTGCTGGTACCAGGACACTGATTTCTCCTTTAAAGAACTTTTGTGGTGGTG[G/A]
TTGTGGGGAACCACTTGTACAGTTCTGCTATAGCTTATCTTTCAGTTGCAATATGGGGATAAGTCCTAAAGAATTAAGAAAGAAATGGCTATAGCCCCAC
GTGGGGCTATAGCCATTTCTTTCTTAATTCTTTAGGACTTATCCCCATATTGCAACTGAAAGATAAGCTATAGCAGAACTGTACAAGTGGTTCCCCACAA[C/T]
CACCACCACAAAAGTTCTTTAAAGGAGAAATCAGTGTCCTGGTACCAGCAGTGTGACATGCTAGGGAAAAAAAAACACATACTAATTGGAGCCATTAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.30% | 3.40% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 9.30% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 72.00% | 26.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 12.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602363435 | G -> A | LOC_Os06g05250.1 | downstream_gene_variant ; 3167.0bp to feature; MODIFIER | silent_mutation | Average:54.772; most accessible tissue: Callus, score: 76.31 | N | N | N | N |
| vg0602363435 | G -> A | LOC_Os06g05250.2 | downstream_gene_variant ; 3634.0bp to feature; MODIFIER | silent_mutation | Average:54.772; most accessible tissue: Callus, score: 76.31 | N | N | N | N |
| vg0602363435 | G -> A | LOC_Os06g05240.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.772; most accessible tissue: Callus, score: 76.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602363435 | NA | 6.98E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 6.64E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | 8.14E-06 | 4.62E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | 5.79E-08 | 5.79E-08 | mr1204 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 3.21E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 7.25E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 1.69E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 4.99E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 5.41E-06 | mr1878 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 6.22E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | 2.07E-06 | 2.07E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 7.80E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602363435 | NA | 2.58E-08 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |