\
| Variant ID: vg0602358935 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2358935 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.10, others allele: 0.00, population size: 250. )
CGGGTAGCAAATGGTTCACTTCATAGCCAAAGCTCCAACTGGAGGATAAATTTTGCCTTCACTAGCTAATGGTCAGTGGTAAATATGATTGGTTGGTGAT[T/G]
ATCAGAAATTTCAGCTGTGTACCCACTTGCCAGGCATTTTCAATAATGTTTTTGAGGAAAAGGCTGTATAATCGTATACATAAGTATTGATGTTGTCCAT
ATGGACAACATCAATACTTATGTATACGATTATACAGCCTTTTCCTCAAAAACATTATTGAAAATGCCTGGCAAGTGGGTACACAGCTGAAATTTCTGAT[A/C]
ATCACCAACCAATCATATTTACCACTGACCATTAGCTAGTGAAGGCAAAATTTATCCTCCAGTTGGAGCTTTGGCTATGAAGTGAACCATTTGCTACCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 40.40% | 0.00% | 0.36% | NA |
| All Indica | 2759 | 87.50% | 12.00% | 0.00% | 0.51% | NA |
| All Japonica | 1512 | 1.30% | 98.60% | 0.00% | 0.13% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.80% | 0.00% | 0.50% | NA |
| Indica II | 465 | 53.10% | 46.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 98.00% | 1.80% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 87.00% | 12.20% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 97.80% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 57.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602358935 | T -> G | LOC_Os06g05240.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.223; most accessible tissue: Callus, score: 90.182 | N | N | N | N |
| vg0602358935 | T -> DEL | N | N | silent_mutation | Average:65.223; most accessible tissue: Callus, score: 90.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602358935 | NA | 3.79E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 3.48E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | 1.12E-25 | 3.03E-104 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | 3.62E-19 | 5.91E-43 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 7.37E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 1.06E-21 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 7.22E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 6.20E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 1.07E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 8.18E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 1.53E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | 6.57E-24 | 2.81E-113 | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | 2.09E-16 | 2.74E-41 | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 6.84E-27 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 4.75E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 1.49E-27 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602358935 | NA | 1.21E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |