\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602175867:

Variant ID: vg0602175867 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2175867
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCTTAATTATACATGACCCATTTTATCTCTTACCATTTGTCCATTGCAGTAATTTGATTATTTCGCACGAATTTTCTGTTTATACGAGCAAACAATAC[A/G]
CTGAACAGGAAGAGTACAATAACAATACTAGTTGTGTTGTGATTTCTGAACATTATTACTGCAGCAGTGTTACATGAAGTTATTAGTACAAGATAGGAGT

Reverse complement sequence

ACTCCTATCTTGTACTAATAACTTCATGTAACACTGCTGCAGTAATAATGTTCAGAAATCACAACACAACTAGTATTGTTATTGTACTCTTCCTGTTCAG[T/C]
GTATTGTTTGCTCGTATAAACAGAAAATTCGTGCGAAATAATCAAATTACTGCAATGGACAAATGGTAAGAGATAAAATGGGTCATGTATAATTAAGGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.90% 0.90% 0.17% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 97.00% 2.50% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 91.70% 6.90% 1.39% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602175867 A -> G LOC_Os06g04930.1 upstream_gene_variant ; 2467.0bp to feature; MODIFIER silent_mutation Average:47.174; most accessible tissue: Callus, score: 78.184 N N N N
vg0602175867 A -> G LOC_Os06g04940.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:47.174; most accessible tissue: Callus, score: 78.184 N N N N
vg0602175867 A -> G LOC_Os06g04950.1 downstream_gene_variant ; 4331.0bp to feature; MODIFIER silent_mutation Average:47.174; most accessible tissue: Callus, score: 78.184 N N N N
vg0602175867 A -> G LOC_Os06g04940.2 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:47.174; most accessible tissue: Callus, score: 78.184 N N N N
vg0602175867 A -> G LOC_Os06g04930-LOC_Os06g04940 intergenic_region ; MODIFIER silent_mutation Average:47.174; most accessible tissue: Callus, score: 78.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602175867 NA 1.59E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602175867 NA 5.96E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602175867 NA 1.92E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602175867 NA 3.87E-07 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602175867 NA 2.68E-06 mr1636 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602175867 1.08E-06 1.08E-06 mr1663 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251