\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602091036:

Variant ID: vg0602091036 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2091036
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTAATTGGATGAAATGAGAGACTATTTATTGAGTTGGTAGTTCATGATATACTATATTCTTCTCTTGGGAAGGCTTACTTGAAGCGATAACTGTTTT[T/A]
GTGACGCTGAAACATTTCACTCGCAAGCTGAATTTTCGTTGGAGTCTCTGCACTGTCCATCGCTTAACTTATCTTATTTGCAAGTTCCATGTAGAAGGCG

Reverse complement sequence

CGCCTTCTACATGGAACTTGCAAATAAGATAAGTTAAGCGATGGACAGTGCAGAGACTCCAACGAAAATTCAGCTTGCGAGTGAAATGTTTCAGCGTCAC[A/T]
AAAACAGTTATCGCTTCAAGTAAGCCTTCCCAAGAGAAGAATATAGTATATCATGAACTACCAACTCAATAAATAGTCTCTCATTTCATCCAATTACATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 11.10% 1.40% 0.00% NA
All Indica  2759 78.90% 18.70% 2.36% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 46.40% 46.10% 7.56% 0.00% NA
Indica II  465 72.50% 25.40% 2.15% 0.00% NA
Indica III  913 98.20% 1.80% 0.00% 0.00% NA
Indica Intermediate  786 85.00% 13.70% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602091036 T -> A LOC_Os06g04780.1 downstream_gene_variant ; 3636.0bp to feature; MODIFIER silent_mutation Average:60.979; most accessible tissue: Callus, score: 85.954 N N N N
vg0602091036 T -> A LOC_Os06g04790.1 downstream_gene_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:60.979; most accessible tissue: Callus, score: 85.954 N N N N
vg0602091036 T -> A LOC_Os06g04800.1 downstream_gene_variant ; 169.0bp to feature; MODIFIER silent_mutation Average:60.979; most accessible tissue: Callus, score: 85.954 N N N N
vg0602091036 T -> A LOC_Os06g04810.1 downstream_gene_variant ; 4530.0bp to feature; MODIFIER silent_mutation Average:60.979; most accessible tissue: Callus, score: 85.954 N N N N
vg0602091036 T -> A LOC_Os06g04790-LOC_Os06g04800 intergenic_region ; MODIFIER silent_mutation Average:60.979; most accessible tissue: Callus, score: 85.954 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602091036 NA 2.74E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602091036 NA 9.52E-10 mr1850 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602091036 3.19E-06 3.19E-06 mr1850 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602091036 NA 7.44E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251