\
| Variant ID: vg0602091036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2091036 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATGTAATTGGATGAAATGAGAGACTATTTATTGAGTTGGTAGTTCATGATATACTATATTCTTCTCTTGGGAAGGCTTACTTGAAGCGATAACTGTTTT[T/A]
GTGACGCTGAAACATTTCACTCGCAAGCTGAATTTTCGTTGGAGTCTCTGCACTGTCCATCGCTTAACTTATCTTATTTGCAAGTTCCATGTAGAAGGCG
CGCCTTCTACATGGAACTTGCAAATAAGATAAGTTAAGCGATGGACAGTGCAGAGACTCCAACGAAAATTCAGCTTGCGAGTGAAATGTTTCAGCGTCAC[A/T]
AAAACAGTTATCGCTTCAAGTAAGCCTTCCCAAGAGAAGAATATAGTATATCATGAACTACCAACTCAATAAATAGTCTCTCATTTCATCCAATTACATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 11.10% | 1.40% | 0.00% | NA |
| All Indica | 2759 | 78.90% | 18.70% | 2.36% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.40% | 46.10% | 7.56% | 0.00% | NA |
| Indica II | 465 | 72.50% | 25.40% | 2.15% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 13.70% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602091036 | T -> A | LOC_Os06g04780.1 | downstream_gene_variant ; 3636.0bp to feature; MODIFIER | silent_mutation | Average:60.979; most accessible tissue: Callus, score: 85.954 | N | N | N | N |
| vg0602091036 | T -> A | LOC_Os06g04790.1 | downstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:60.979; most accessible tissue: Callus, score: 85.954 | N | N | N | N |
| vg0602091036 | T -> A | LOC_Os06g04800.1 | downstream_gene_variant ; 169.0bp to feature; MODIFIER | silent_mutation | Average:60.979; most accessible tissue: Callus, score: 85.954 | N | N | N | N |
| vg0602091036 | T -> A | LOC_Os06g04810.1 | downstream_gene_variant ; 4530.0bp to feature; MODIFIER | silent_mutation | Average:60.979; most accessible tissue: Callus, score: 85.954 | N | N | N | N |
| vg0602091036 | T -> A | LOC_Os06g04790-LOC_Os06g04800 | intergenic_region ; MODIFIER | silent_mutation | Average:60.979; most accessible tissue: Callus, score: 85.954 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602091036 | NA | 2.74E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602091036 | NA | 9.52E-10 | mr1850 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602091036 | 3.19E-06 | 3.19E-06 | mr1850 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602091036 | NA | 7.44E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |