| Variant ID: vg0602036061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2036061 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 116. )
AACAGGGGGTGCTATGGACTGTCCAGATTCGTAGTATGTCACATGTTTTTTTTTGACGAATGGAGTATCACGTAGTCAATACTCTATTATGATTTAATTA[T/C]
CTTTACAAATTAGATACGATGTAAAGATGAAAACGGCTATAAAAATTCCCGACCAACCGAGTATCCTTTATGGATAAAGTGCTACCGTTTTCGACCGTAT
ATACGGTCGAAAACGGTAGCACTTTATCCATAAAGGATACTCGGTTGGTCGGGAATTTTTATAGCCGTTTTCATCTTTACATCGTATCTAATTTGTAAAG[A/G]
TAATTAAATCATAATAGAGTATTGACTACGTGATACTCCATTCGTCAAAAAAAAACATGTGACATACTACGAATCTGGACAGTCCATAGCACCCCCTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 39.50% | 0.19% | 0.32% | NA |
| All Indica | 2759 | 76.00% | 23.50% | 0.14% | 0.36% | NA |
| All Japonica | 1512 | 22.80% | 76.70% | 0.20% | 0.26% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 52.30% | 47.30% | 0.22% | 0.22% | NA |
| Indica III | 913 | 77.10% | 22.30% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 74.70% | 24.80% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 94.00% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 11.20% | 88.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602036061 | T -> C | LOC_Os06g04670.1 | upstream_gene_variant ; 710.0bp to feature; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> C | LOC_Os06g04660.1 | downstream_gene_variant ; 1248.0bp to feature; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> C | LOC_Os06g04680.1 | downstream_gene_variant ; 3673.0bp to feature; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> C | LOC_Os06g04660.2 | downstream_gene_variant ; 1248.0bp to feature; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> C | LOC_Os06g04680.2 | downstream_gene_variant ; 3241.0bp to feature; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> C | LOC_Os06g04660-LOC_Os06g04670 | intergenic_region ; MODIFIER | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| vg0602036061 | T -> DEL | N | N | silent_mutation | Average:66.878; most accessible tissue: Callus, score: 87.196 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602036061 | 5.08E-08 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0602036061 | NA | 1.24E-12 | Awn_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0602036061 | NA | 9.38E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | 1.85E-08 | 5.24E-51 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | 4.05E-09 | 7.36E-24 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | NA | 2.79E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | NA | 9.21E-06 | mr1272 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | NA | 2.80E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | NA | 1.19E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602036061 | NA | 4.53E-20 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/